ID: 929570808

View in Genome Browser
Species Human (GRCh38)
Location 2:43021891-43021913
Sequence CCGGCTGCAGCAAGCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570808_929570823 17 Left 929570808 2:43021891-43021913 CCTCCCAGGCTTGCTGCAGCCGG No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570808_929570814 -8 Left 929570808 2:43021891-43021913 CCTCCCAGGCTTGCTGCAGCCGG No data
Right 929570814 2:43021906-43021928 GCAGCCGGCCCAGCTGCGAGGGG No data
929570808_929570818 0 Left 929570808 2:43021891-43021913 CCTCCCAGGCTTGCTGCAGCCGG No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570808_929570815 -7 Left 929570808 2:43021891-43021913 CCTCCCAGGCTTGCTGCAGCCGG No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570808_929570820 4 Left 929570808 2:43021891-43021913 CCTCCCAGGCTTGCTGCAGCCGG No data
Right 929570820 2:43021918-43021940 GCTGCGAGGGGGCCCGAGGACGG No data
929570808_929570812 -10 Left 929570808 2:43021891-43021913 CCTCCCAGGCTTGCTGCAGCCGG No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570808_929570813 -9 Left 929570808 2:43021891-43021913 CCTCCCAGGCTTGCTGCAGCCGG No data
Right 929570813 2:43021905-43021927 TGCAGCCGGCCCAGCTGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929570808 Original CRISPR CCGGCTGCAGCAAGCCTGGG AGG (reversed) Intergenic