ID: 929570810

View in Genome Browser
Species Human (GRCh38)
Location 2:43021894-43021916
Sequence GGGCCGGCTGCAGCAAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570810_929570824 30 Left 929570810 2:43021894-43021916 CCCAGGCTTGCTGCAGCCGGCCC No data
Right 929570824 2:43021947-43021969 ACAAAGGCCCCATTCTCAGCTGG No data
929570810_929570815 -10 Left 929570810 2:43021894-43021916 CCCAGGCTTGCTGCAGCCGGCCC No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570810_929570820 1 Left 929570810 2:43021894-43021916 CCCAGGCTTGCTGCAGCCGGCCC No data
Right 929570820 2:43021918-43021940 GCTGCGAGGGGGCCCGAGGACGG No data
929570810_929570818 -3 Left 929570810 2:43021894-43021916 CCCAGGCTTGCTGCAGCCGGCCC No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570810_929570823 14 Left 929570810 2:43021894-43021916 CCCAGGCTTGCTGCAGCCGGCCC No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929570810 Original CRISPR GGGCCGGCTGCAGCAAGCCT GGG (reversed) Intergenic