ID: 929570811

View in Genome Browser
Species Human (GRCh38)
Location 2:43021895-43021917
Sequence TGGGCCGGCTGCAGCAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570811_929570818 -4 Left 929570811 2:43021895-43021917 CCAGGCTTGCTGCAGCCGGCCCA No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570811_929570820 0 Left 929570811 2:43021895-43021917 CCAGGCTTGCTGCAGCCGGCCCA No data
Right 929570820 2:43021918-43021940 GCTGCGAGGGGGCCCGAGGACGG No data
929570811_929570823 13 Left 929570811 2:43021895-43021917 CCAGGCTTGCTGCAGCCGGCCCA No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570811_929570824 29 Left 929570811 2:43021895-43021917 CCAGGCTTGCTGCAGCCGGCCCA No data
Right 929570824 2:43021947-43021969 ACAAAGGCCCCATTCTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929570811 Original CRISPR TGGGCCGGCTGCAGCAAGCC TGG (reversed) Intergenic