ID: 929570812

View in Genome Browser
Species Human (GRCh38)
Location 2:43021904-43021926
Sequence CTGCAGCCGGCCCAGCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570800_929570812 12 Left 929570800 2:43021869-43021891 CCGCCGCCTGCCATCCAGCCCTC No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570807_929570812 -7 Left 929570807 2:43021888-43021910 CCTCCTCCCAGGCTTGCTGCAGC No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570797_929570812 17 Left 929570797 2:43021864-43021886 CCCCGCCGCCGCCTGCCATCCAG No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570794_929570812 26 Left 929570794 2:43021855-43021877 CCCATCCAGCCCCGCCGCCGCCT No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570804_929570812 2 Left 929570804 2:43021879-43021901 CCATCCAGCCCTCCTCCCAGGCT No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570796_929570812 21 Left 929570796 2:43021860-43021882 CCAGCCCCGCCGCCGCCTGCCAT No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570795_929570812 25 Left 929570795 2:43021856-43021878 CCATCCAGCCCCGCCGCCGCCTG No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570802_929570812 6 Left 929570802 2:43021875-43021897 CCTGCCATCCAGCCCTCCTCCCA No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570801_929570812 9 Left 929570801 2:43021872-43021894 CCGCCTGCCATCCAGCCCTCCTC No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570805_929570812 -2 Left 929570805 2:43021883-43021905 CCAGCCCTCCTCCCAGGCTTGCT No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570806_929570812 -6 Left 929570806 2:43021887-43021909 CCCTCCTCCCAGGCTTGCTGCAG No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570798_929570812 16 Left 929570798 2:43021865-43021887 CCCGCCGCCGCCTGCCATCCAGC No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570799_929570812 15 Left 929570799 2:43021866-43021888 CCGCCGCCGCCTGCCATCCAGCC No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data
929570808_929570812 -10 Left 929570808 2:43021891-43021913 CCTCCCAGGCTTGCTGCAGCCGG No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929570812 Original CRISPR CTGCAGCCGGCCCAGCTGCG AGG Intergenic