ID: 929570815

View in Genome Browser
Species Human (GRCh38)
Location 2:43021907-43021929
Sequence CAGCCGGCCCAGCTGCGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570806_929570815 -3 Left 929570806 2:43021887-43021909 CCCTCCTCCCAGGCTTGCTGCAG No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570796_929570815 24 Left 929570796 2:43021860-43021882 CCAGCCCCGCCGCCGCCTGCCAT No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570798_929570815 19 Left 929570798 2:43021865-43021887 CCCGCCGCCGCCTGCCATCCAGC No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570795_929570815 28 Left 929570795 2:43021856-43021878 CCATCCAGCCCCGCCGCCGCCTG No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570807_929570815 -4 Left 929570807 2:43021888-43021910 CCTCCTCCCAGGCTTGCTGCAGC No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570810_929570815 -10 Left 929570810 2:43021894-43021916 CCCAGGCTTGCTGCAGCCGGCCC No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570800_929570815 15 Left 929570800 2:43021869-43021891 CCGCCGCCTGCCATCCAGCCCTC No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570797_929570815 20 Left 929570797 2:43021864-43021886 CCCCGCCGCCGCCTGCCATCCAG No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570794_929570815 29 Left 929570794 2:43021855-43021877 CCCATCCAGCCCCGCCGCCGCCT No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570804_929570815 5 Left 929570804 2:43021879-43021901 CCATCCAGCCCTCCTCCCAGGCT No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570801_929570815 12 Left 929570801 2:43021872-43021894 CCGCCTGCCATCCAGCCCTCCTC No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570802_929570815 9 Left 929570802 2:43021875-43021897 CCTGCCATCCAGCCCTCCTCCCA No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570805_929570815 1 Left 929570805 2:43021883-43021905 CCAGCCCTCCTCCCAGGCTTGCT No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570808_929570815 -7 Left 929570808 2:43021891-43021913 CCTCCCAGGCTTGCTGCAGCCGG No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570799_929570815 18 Left 929570799 2:43021866-43021888 CCGCCGCCGCCTGCCATCCAGCC No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929570815 Original CRISPR CAGCCGGCCCAGCTGCGAGG GGG Intergenic