ID: 929570817

View in Genome Browser
Species Human (GRCh38)
Location 2:43021914-43021936
Sequence CCTCGGGCCCCCTCGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570817_929570823 -6 Left 929570817 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570817_929570828 16 Left 929570817 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
Right 929570828 2:43021953-43021975 GCCCCATTCTCAGCTGGCGGGGG No data
929570817_929570824 10 Left 929570817 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
Right 929570824 2:43021947-43021969 ACAAAGGCCCCATTCTCAGCTGG No data
929570817_929570827 15 Left 929570817 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
Right 929570827 2:43021952-43021974 GGCCCCATTCTCAGCTGGCGGGG No data
929570817_929570825 13 Left 929570817 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
Right 929570825 2:43021950-43021972 AAGGCCCCATTCTCAGCTGGCGG No data
929570817_929570826 14 Left 929570817 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
Right 929570826 2:43021951-43021973 AGGCCCCATTCTCAGCTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929570817 Original CRISPR CCTCGGGCCCCCTCGCAGCT GGG (reversed) Intergenic