ID: 929570818

View in Genome Browser
Species Human (GRCh38)
Location 2:43021914-43021936
Sequence CCCAGCTGCGAGGGGGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570806_929570818 4 Left 929570806 2:43021887-43021909 CCCTCCTCCCAGGCTTGCTGCAG No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570804_929570818 12 Left 929570804 2:43021879-43021901 CCATCCAGCCCTCCTCCCAGGCT No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570798_929570818 26 Left 929570798 2:43021865-43021887 CCCGCCGCCGCCTGCCATCCAGC No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570808_929570818 0 Left 929570808 2:43021891-43021913 CCTCCCAGGCTTGCTGCAGCCGG No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570805_929570818 8 Left 929570805 2:43021883-43021905 CCAGCCCTCCTCCCAGGCTTGCT No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570807_929570818 3 Left 929570807 2:43021888-43021910 CCTCCTCCCAGGCTTGCTGCAGC No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570797_929570818 27 Left 929570797 2:43021864-43021886 CCCCGCCGCCGCCTGCCATCCAG No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570811_929570818 -4 Left 929570811 2:43021895-43021917 CCAGGCTTGCTGCAGCCGGCCCA No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570810_929570818 -3 Left 929570810 2:43021894-43021916 CCCAGGCTTGCTGCAGCCGGCCC No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570800_929570818 22 Left 929570800 2:43021869-43021891 CCGCCGCCTGCCATCCAGCCCTC No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570799_929570818 25 Left 929570799 2:43021866-43021888 CCGCCGCCGCCTGCCATCCAGCC No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570802_929570818 16 Left 929570802 2:43021875-43021897 CCTGCCATCCAGCCCTCCTCCCA No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570801_929570818 19 Left 929570801 2:43021872-43021894 CCGCCTGCCATCCAGCCCTCCTC No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929570818 Original CRISPR CCCAGCTGCGAGGGGGCCCG AGG Intergenic