ID: 929570819

View in Genome Browser
Species Human (GRCh38)
Location 2:43021915-43021937
Sequence TCCTCGGGCCCCCTCGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570819_929570823 -7 Left 929570819 2:43021915-43021937 CCAGCTGCGAGGGGGCCCGAGGA No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570819_929570825 12 Left 929570819 2:43021915-43021937 CCAGCTGCGAGGGGGCCCGAGGA No data
Right 929570825 2:43021950-43021972 AAGGCCCCATTCTCAGCTGGCGG No data
929570819_929570828 15 Left 929570819 2:43021915-43021937 CCAGCTGCGAGGGGGCCCGAGGA No data
Right 929570828 2:43021953-43021975 GCCCCATTCTCAGCTGGCGGGGG No data
929570819_929570824 9 Left 929570819 2:43021915-43021937 CCAGCTGCGAGGGGGCCCGAGGA No data
Right 929570824 2:43021947-43021969 ACAAAGGCCCCATTCTCAGCTGG No data
929570819_929570827 14 Left 929570819 2:43021915-43021937 CCAGCTGCGAGGGGGCCCGAGGA No data
Right 929570827 2:43021952-43021974 GGCCCCATTCTCAGCTGGCGGGG No data
929570819_929570826 13 Left 929570819 2:43021915-43021937 CCAGCTGCGAGGGGGCCCGAGGA No data
Right 929570826 2:43021951-43021973 AGGCCCCATTCTCAGCTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929570819 Original CRISPR TCCTCGGGCCCCCTCGCAGC TGG (reversed) Intergenic