ID: 929570821

View in Genome Browser
Species Human (GRCh38)
Location 2:43021930-43021952
Sequence CTTTGTGCAGTGCCGTCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570821_929570824 -6 Left 929570821 2:43021930-43021952 CCCGAGGACGGCACTGCACAAAG No data
Right 929570824 2:43021947-43021969 ACAAAGGCCCCATTCTCAGCTGG No data
929570821_929570827 -1 Left 929570821 2:43021930-43021952 CCCGAGGACGGCACTGCACAAAG No data
Right 929570827 2:43021952-43021974 GGCCCCATTCTCAGCTGGCGGGG No data
929570821_929570826 -2 Left 929570821 2:43021930-43021952 CCCGAGGACGGCACTGCACAAAG No data
Right 929570826 2:43021951-43021973 AGGCCCCATTCTCAGCTGGCGGG No data
929570821_929570828 0 Left 929570821 2:43021930-43021952 CCCGAGGACGGCACTGCACAAAG No data
Right 929570828 2:43021953-43021975 GCCCCATTCTCAGCTGGCGGGGG No data
929570821_929570825 -3 Left 929570821 2:43021930-43021952 CCCGAGGACGGCACTGCACAAAG No data
Right 929570825 2:43021950-43021972 AAGGCCCCATTCTCAGCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929570821 Original CRISPR CTTTGTGCAGTGCCGTCCTC GGG (reversed) Intergenic
No off target data available for this crispr