ID: 929570822

View in Genome Browser
Species Human (GRCh38)
Location 2:43021931-43021953
Sequence CCTTTGTGCAGTGCCGTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570822_929570825 -4 Left 929570822 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
Right 929570825 2:43021950-43021972 AAGGCCCCATTCTCAGCTGGCGG No data
929570822_929570826 -3 Left 929570822 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
Right 929570826 2:43021951-43021973 AGGCCCCATTCTCAGCTGGCGGG No data
929570822_929570827 -2 Left 929570822 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
Right 929570827 2:43021952-43021974 GGCCCCATTCTCAGCTGGCGGGG No data
929570822_929570824 -7 Left 929570822 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
Right 929570824 2:43021947-43021969 ACAAAGGCCCCATTCTCAGCTGG No data
929570822_929570828 -1 Left 929570822 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
Right 929570828 2:43021953-43021975 GCCCCATTCTCAGCTGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929570822 Original CRISPR CCTTTGTGCAGTGCCGTCCT CGG (reversed) Intergenic