ID: 929570823

View in Genome Browser
Species Human (GRCh38)
Location 2:43021931-43021953
Sequence CCGAGGACGGCACTGCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570806_929570823 21 Left 929570806 2:43021887-43021909 CCCTCCTCCCAGGCTTGCTGCAG No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570808_929570823 17 Left 929570808 2:43021891-43021913 CCTCCCAGGCTTGCTGCAGCCGG No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570819_929570823 -7 Left 929570819 2:43021915-43021937 CCAGCTGCGAGGGGGCCCGAGGA No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570807_929570823 20 Left 929570807 2:43021888-43021910 CCTCCTCCCAGGCTTGCTGCAGC No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570817_929570823 -6 Left 929570817 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570816_929570823 -2 Left 929570816 2:43021910-43021932 CCGGCCCAGCTGCGAGGGGGCCC No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570804_929570823 29 Left 929570804 2:43021879-43021901 CCATCCAGCCCTCCTCCCAGGCT No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570811_929570823 13 Left 929570811 2:43021895-43021917 CCAGGCTTGCTGCAGCCGGCCCA No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570810_929570823 14 Left 929570810 2:43021894-43021916 CCCAGGCTTGCTGCAGCCGGCCC No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570805_929570823 25 Left 929570805 2:43021883-43021905 CCAGCCCTCCTCCCAGGCTTGCT No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929570823 Original CRISPR CCGAGGACGGCACTGCACAA AGG Intergenic