ID: 929570824

View in Genome Browser
Species Human (GRCh38)
Location 2:43021947-43021969
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570810_929570824 30 Left 929570810 2:43021894-43021916 CCCAGGCTTGCTGCAGCCGGCCC No data
Right 929570824 2:43021947-43021969 ACAAAGGCCCCATTCTCAGCTGG No data
929570816_929570824 14 Left 929570816 2:43021910-43021932 CCGGCCCAGCTGCGAGGGGGCCC No data
Right 929570824 2:43021947-43021969 ACAAAGGCCCCATTCTCAGCTGG No data
929570822_929570824 -7 Left 929570822 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
Right 929570824 2:43021947-43021969 ACAAAGGCCCCATTCTCAGCTGG No data
929570817_929570824 10 Left 929570817 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
Right 929570824 2:43021947-43021969 ACAAAGGCCCCATTCTCAGCTGG No data
929570819_929570824 9 Left 929570819 2:43021915-43021937 CCAGCTGCGAGGGGGCCCGAGGA No data
Right 929570824 2:43021947-43021969 ACAAAGGCCCCATTCTCAGCTGG No data
929570821_929570824 -6 Left 929570821 2:43021930-43021952 CCCGAGGACGGCACTGCACAAAG No data
Right 929570824 2:43021947-43021969 ACAAAGGCCCCATTCTCAGCTGG No data
929570811_929570824 29 Left 929570811 2:43021895-43021917 CCAGGCTTGCTGCAGCCGGCCCA No data
Right 929570824 2:43021947-43021969 ACAAAGGCCCCATTCTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type