ID: 929570826

View in Genome Browser
Species Human (GRCh38)
Location 2:43021951-43021973
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570816_929570826 18 Left 929570816 2:43021910-43021932 CCGGCCCAGCTGCGAGGGGGCCC No data
Right 929570826 2:43021951-43021973 AGGCCCCATTCTCAGCTGGCGGG No data
929570822_929570826 -3 Left 929570822 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
Right 929570826 2:43021951-43021973 AGGCCCCATTCTCAGCTGGCGGG No data
929570817_929570826 14 Left 929570817 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
Right 929570826 2:43021951-43021973 AGGCCCCATTCTCAGCTGGCGGG No data
929570821_929570826 -2 Left 929570821 2:43021930-43021952 CCCGAGGACGGCACTGCACAAAG No data
Right 929570826 2:43021951-43021973 AGGCCCCATTCTCAGCTGGCGGG No data
929570819_929570826 13 Left 929570819 2:43021915-43021937 CCAGCTGCGAGGGGGCCCGAGGA No data
Right 929570826 2:43021951-43021973 AGGCCCCATTCTCAGCTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type