ID: 929570828

View in Genome Browser
Species Human (GRCh38)
Location 2:43021953-43021975
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570819_929570828 15 Left 929570819 2:43021915-43021937 CCAGCTGCGAGGGGGCCCGAGGA No data
Right 929570828 2:43021953-43021975 GCCCCATTCTCAGCTGGCGGGGG No data
929570816_929570828 20 Left 929570816 2:43021910-43021932 CCGGCCCAGCTGCGAGGGGGCCC No data
Right 929570828 2:43021953-43021975 GCCCCATTCTCAGCTGGCGGGGG No data
929570822_929570828 -1 Left 929570822 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
Right 929570828 2:43021953-43021975 GCCCCATTCTCAGCTGGCGGGGG No data
929570817_929570828 16 Left 929570817 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
Right 929570828 2:43021953-43021975 GCCCCATTCTCAGCTGGCGGGGG No data
929570821_929570828 0 Left 929570821 2:43021930-43021952 CCCGAGGACGGCACTGCACAAAG No data
Right 929570828 2:43021953-43021975 GCCCCATTCTCAGCTGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr