ID: 929571667

View in Genome Browser
Species Human (GRCh38)
Location 2:43026784-43026806
Sequence GGGCTAGATGTGGAGCCGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929571667_929571670 -8 Left 929571667 2:43026784-43026806 CCAACCGGCTCCACATCTAGCCC No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571667_929571678 26 Left 929571667 2:43026784-43026806 CCAACCGGCTCCACATCTAGCCC No data
Right 929571678 2:43026833-43026855 TCTCCCTGAACGCTCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929571667 Original CRISPR GGGCTAGATGTGGAGCCGGT TGG (reversed) Intergenic
No off target data available for this crispr