ID: 929571670

View in Genome Browser
Species Human (GRCh38)
Location 2:43026799-43026821
Sequence TCTAGCCCCCGCCAGACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929571661_929571670 5 Left 929571661 2:43026771-43026793 CCCTCATCCCCACCCAACCGGCT No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571666_929571670 -7 Left 929571666 2:43026783-43026805 CCCAACCGGCTCCACATCTAGCC No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571656_929571670 16 Left 929571656 2:43026760-43026782 CCCCTGAGCCTCCCTCATCCCCA No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571659_929571670 8 Left 929571659 2:43026768-43026790 CCTCCCTCATCCCCACCCAACCG No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571667_929571670 -8 Left 929571667 2:43026784-43026806 CCAACCGGCTCCACATCTAGCCC No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571653_929571670 24 Left 929571653 2:43026752-43026774 CCCCTAAACCCCTGAGCCTCCCT No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571655_929571670 22 Left 929571655 2:43026754-43026776 CCTAAACCCCTGAGCCTCCCTCA No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571654_929571670 23 Left 929571654 2:43026753-43026775 CCCTAAACCCCTGAGCCTCCCTC No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571657_929571670 15 Left 929571657 2:43026761-43026783 CCCTGAGCCTCCCTCATCCCCAC No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571665_929571670 -4 Left 929571665 2:43026780-43026802 CCACCCAACCGGCTCCACATCTA No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571663_929571670 -2 Left 929571663 2:43026778-43026800 CCCCACCCAACCGGCTCCACATC No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571664_929571670 -3 Left 929571664 2:43026779-43026801 CCCACCCAACCGGCTCCACATCT No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571662_929571670 4 Left 929571662 2:43026772-43026794 CCTCATCCCCACCCAACCGGCTC No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data
929571658_929571670 14 Left 929571658 2:43026762-43026784 CCTGAGCCTCCCTCATCCCCACC No data
Right 929571670 2:43026799-43026821 TCTAGCCCCCGCCAGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929571670 Original CRISPR TCTAGCCCCCGCCAGACCTC AGG Intergenic
No off target data available for this crispr