ID: 929571678

View in Genome Browser
Species Human (GRCh38)
Location 2:43026833-43026855
Sequence TCTCCCTGAACGCTCCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929571672_929571678 5 Left 929571672 2:43026805-43026827 CCCCGCCAGACCTCAGGCTTGTG No data
Right 929571678 2:43026833-43026855 TCTCCCTGAACGCTCCTCTCTGG No data
929571671_929571678 6 Left 929571671 2:43026804-43026826 CCCCCGCCAGACCTCAGGCTTGT No data
Right 929571678 2:43026833-43026855 TCTCCCTGAACGCTCCTCTCTGG No data
929571669_929571678 16 Left 929571669 2:43026794-43026816 CCACATCTAGCCCCCGCCAGACC No data
Right 929571678 2:43026833-43026855 TCTCCCTGAACGCTCCTCTCTGG No data
929571668_929571678 22 Left 929571668 2:43026788-43026810 CCGGCTCCACATCTAGCCCCCGC No data
Right 929571678 2:43026833-43026855 TCTCCCTGAACGCTCCTCTCTGG No data
929571666_929571678 27 Left 929571666 2:43026783-43026805 CCCAACCGGCTCCACATCTAGCC No data
Right 929571678 2:43026833-43026855 TCTCCCTGAACGCTCCTCTCTGG No data
929571674_929571678 3 Left 929571674 2:43026807-43026829 CCGCCAGACCTCAGGCTTGTGTC No data
Right 929571678 2:43026833-43026855 TCTCCCTGAACGCTCCTCTCTGG No data
929571665_929571678 30 Left 929571665 2:43026780-43026802 CCACCCAACCGGCTCCACATCTA No data
Right 929571678 2:43026833-43026855 TCTCCCTGAACGCTCCTCTCTGG No data
929571675_929571678 0 Left 929571675 2:43026810-43026832 CCAGACCTCAGGCTTGTGTCCAC No data
Right 929571678 2:43026833-43026855 TCTCCCTGAACGCTCCTCTCTGG No data
929571673_929571678 4 Left 929571673 2:43026806-43026828 CCCGCCAGACCTCAGGCTTGTGT No data
Right 929571678 2:43026833-43026855 TCTCCCTGAACGCTCCTCTCTGG No data
929571676_929571678 -5 Left 929571676 2:43026815-43026837 CCTCAGGCTTGTGTCCACTCTCC No data
Right 929571678 2:43026833-43026855 TCTCCCTGAACGCTCCTCTCTGG No data
929571667_929571678 26 Left 929571667 2:43026784-43026806 CCAACCGGCTCCACATCTAGCCC No data
Right 929571678 2:43026833-43026855 TCTCCCTGAACGCTCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929571678 Original CRISPR TCTCCCTGAACGCTCCTCTC TGG Intergenic
No off target data available for this crispr