ID: 929572253

View in Genome Browser
Species Human (GRCh38)
Location 2:43030065-43030087
Sequence TGAGCTGGCAGGAGGGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929572253_929572263 7 Left 929572253 2:43030065-43030087 CCTGAGCCCCTCCTGCCAGCTCA No data
Right 929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG No data
929572253_929572259 -4 Left 929572253 2:43030065-43030087 CCTGAGCCCCTCCTGCCAGCTCA No data
Right 929572259 2:43030084-43030106 CTCAGTCCCTGCAGCCACACTGG No data
929572253_929572265 15 Left 929572253 2:43030065-43030087 CCTGAGCCCCTCCTGCCAGCTCA No data
Right 929572265 2:43030103-43030125 CTGGCCCTCATTGGGTTCCCTGG No data
929572253_929572262 6 Left 929572253 2:43030065-43030087 CCTGAGCCCCTCCTGCCAGCTCA No data
Right 929572262 2:43030094-43030116 GCAGCCACACTGGCCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929572253 Original CRISPR TGAGCTGGCAGGAGGGGCTC AGG (reversed) Intergenic
No off target data available for this crispr