ID: 929572254

View in Genome Browser
Species Human (GRCh38)
Location 2:43030071-43030093
Sequence AGGGACTGAGCTGGCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929572254_929572262 0 Left 929572254 2:43030071-43030093 CCCCTCCTGCCAGCTCAGTCCCT No data
Right 929572262 2:43030094-43030116 GCAGCCACACTGGCCCTCATTGG No data
929572254_929572263 1 Left 929572254 2:43030071-43030093 CCCCTCCTGCCAGCTCAGTCCCT No data
Right 929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG No data
929572254_929572259 -10 Left 929572254 2:43030071-43030093 CCCCTCCTGCCAGCTCAGTCCCT No data
Right 929572259 2:43030084-43030106 CTCAGTCCCTGCAGCCACACTGG No data
929572254_929572265 9 Left 929572254 2:43030071-43030093 CCCCTCCTGCCAGCTCAGTCCCT No data
Right 929572265 2:43030103-43030125 CTGGCCCTCATTGGGTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929572254 Original CRISPR AGGGACTGAGCTGGCAGGAG GGG (reversed) Intergenic