ID: 929572255

View in Genome Browser
Species Human (GRCh38)
Location 2:43030072-43030094
Sequence CAGGGACTGAGCTGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929572255_929572262 -1 Left 929572255 2:43030072-43030094 CCCTCCTGCCAGCTCAGTCCCTG No data
Right 929572262 2:43030094-43030116 GCAGCCACACTGGCCCTCATTGG No data
929572255_929572265 8 Left 929572255 2:43030072-43030094 CCCTCCTGCCAGCTCAGTCCCTG No data
Right 929572265 2:43030103-43030125 CTGGCCCTCATTGGGTTCCCTGG No data
929572255_929572270 30 Left 929572255 2:43030072-43030094 CCCTCCTGCCAGCTCAGTCCCTG No data
Right 929572270 2:43030125-43030147 GTGTCCATCCTCCCCACCTCAGG No data
929572255_929572263 0 Left 929572255 2:43030072-43030094 CCCTCCTGCCAGCTCAGTCCCTG No data
Right 929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929572255 Original CRISPR CAGGGACTGAGCTGGCAGGA GGG (reversed) Intergenic