ID: 929572256

View in Genome Browser
Species Human (GRCh38)
Location 2:43030073-43030095
Sequence GCAGGGACTGAGCTGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929572256_929572263 -1 Left 929572256 2:43030073-43030095 CCTCCTGCCAGCTCAGTCCCTGC No data
Right 929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG No data
929572256_929572271 30 Left 929572256 2:43030073-43030095 CCTCCTGCCAGCTCAGTCCCTGC No data
Right 929572271 2:43030126-43030148 TGTCCATCCTCCCCACCTCAGGG No data
929572256_929572265 7 Left 929572256 2:43030073-43030095 CCTCCTGCCAGCTCAGTCCCTGC No data
Right 929572265 2:43030103-43030125 CTGGCCCTCATTGGGTTCCCTGG No data
929572256_929572270 29 Left 929572256 2:43030073-43030095 CCTCCTGCCAGCTCAGTCCCTGC No data
Right 929572270 2:43030125-43030147 GTGTCCATCCTCCCCACCTCAGG No data
929572256_929572262 -2 Left 929572256 2:43030073-43030095 CCTCCTGCCAGCTCAGTCCCTGC No data
Right 929572262 2:43030094-43030116 GCAGCCACACTGGCCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929572256 Original CRISPR GCAGGGACTGAGCTGGCAGG AGG (reversed) Intergenic