ID: 929572258

View in Genome Browser
Species Human (GRCh38)
Location 2:43030080-43030102
Sequence TGTGGCTGCAGGGACTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929572258_929572262 -9 Left 929572258 2:43030080-43030102 CCAGCTCAGTCCCTGCAGCCACA No data
Right 929572262 2:43030094-43030116 GCAGCCACACTGGCCCTCATTGG No data
929572258_929572265 0 Left 929572258 2:43030080-43030102 CCAGCTCAGTCCCTGCAGCCACA No data
Right 929572265 2:43030103-43030125 CTGGCCCTCATTGGGTTCCCTGG No data
929572258_929572263 -8 Left 929572258 2:43030080-43030102 CCAGCTCAGTCCCTGCAGCCACA No data
Right 929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG No data
929572258_929572271 23 Left 929572258 2:43030080-43030102 CCAGCTCAGTCCCTGCAGCCACA No data
Right 929572271 2:43030126-43030148 TGTCCATCCTCCCCACCTCAGGG No data
929572258_929572270 22 Left 929572258 2:43030080-43030102 CCAGCTCAGTCCCTGCAGCCACA No data
Right 929572270 2:43030125-43030147 GTGTCCATCCTCCCCACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929572258 Original CRISPR TGTGGCTGCAGGGACTGAGC TGG (reversed) Intergenic
No off target data available for this crispr