ID: 929572259

View in Genome Browser
Species Human (GRCh38)
Location 2:43030084-43030106
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929572254_929572259 -10 Left 929572254 2:43030071-43030093 CCCCTCCTGCCAGCTCAGTCCCT No data
Right 929572259 2:43030084-43030106 CTCAGTCCCTGCAGCCACACTGG No data
929572252_929572259 20 Left 929572252 2:43030041-43030063 CCATCTTCAATATCAGTTGCTGC No data
Right 929572259 2:43030084-43030106 CTCAGTCCCTGCAGCCACACTGG No data
929572251_929572259 26 Left 929572251 2:43030035-43030057 CCTTGGCCATCTTCAATATCAGT No data
Right 929572259 2:43030084-43030106 CTCAGTCCCTGCAGCCACACTGG No data
929572253_929572259 -4 Left 929572253 2:43030065-43030087 CCTGAGCCCCTCCTGCCAGCTCA No data
Right 929572259 2:43030084-43030106 CTCAGTCCCTGCAGCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type