ID: 929572262

View in Genome Browser
Species Human (GRCh38)
Location 2:43030094-43030116
Sequence GCAGCCACACTGGCCCTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929572258_929572262 -9 Left 929572258 2:43030080-43030102 CCAGCTCAGTCCCTGCAGCCACA No data
Right 929572262 2:43030094-43030116 GCAGCCACACTGGCCCTCATTGG No data
929572256_929572262 -2 Left 929572256 2:43030073-43030095 CCTCCTGCCAGCTCAGTCCCTGC No data
Right 929572262 2:43030094-43030116 GCAGCCACACTGGCCCTCATTGG No data
929572252_929572262 30 Left 929572252 2:43030041-43030063 CCATCTTCAATATCAGTTGCTGC No data
Right 929572262 2:43030094-43030116 GCAGCCACACTGGCCCTCATTGG No data
929572257_929572262 -5 Left 929572257 2:43030076-43030098 CCTGCCAGCTCAGTCCCTGCAGC No data
Right 929572262 2:43030094-43030116 GCAGCCACACTGGCCCTCATTGG No data
929572255_929572262 -1 Left 929572255 2:43030072-43030094 CCCTCCTGCCAGCTCAGTCCCTG No data
Right 929572262 2:43030094-43030116 GCAGCCACACTGGCCCTCATTGG No data
929572253_929572262 6 Left 929572253 2:43030065-43030087 CCTGAGCCCCTCCTGCCAGCTCA No data
Right 929572262 2:43030094-43030116 GCAGCCACACTGGCCCTCATTGG No data
929572254_929572262 0 Left 929572254 2:43030071-43030093 CCCCTCCTGCCAGCTCAGTCCCT No data
Right 929572262 2:43030094-43030116 GCAGCCACACTGGCCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929572262 Original CRISPR GCAGCCACACTGGCCCTCAT TGG Intergenic