ID: 929572263

View in Genome Browser
Species Human (GRCh38)
Location 2:43030095-43030117
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929572258_929572263 -8 Left 929572258 2:43030080-43030102 CCAGCTCAGTCCCTGCAGCCACA No data
Right 929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG No data
929572257_929572263 -4 Left 929572257 2:43030076-43030098 CCTGCCAGCTCAGTCCCTGCAGC No data
Right 929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG No data
929572255_929572263 0 Left 929572255 2:43030072-43030094 CCCTCCTGCCAGCTCAGTCCCTG No data
Right 929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG No data
929572254_929572263 1 Left 929572254 2:43030071-43030093 CCCCTCCTGCCAGCTCAGTCCCT No data
Right 929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG No data
929572256_929572263 -1 Left 929572256 2:43030073-43030095 CCTCCTGCCAGCTCAGTCCCTGC No data
Right 929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG No data
929572253_929572263 7 Left 929572253 2:43030065-43030087 CCTGAGCCCCTCCTGCCAGCTCA No data
Right 929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type