ID: 929572271

View in Genome Browser
Species Human (GRCh38)
Location 2:43030126-43030148
Sequence TGTCCATCCTCCCCACCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929572257_929572271 27 Left 929572257 2:43030076-43030098 CCTGCCAGCTCAGTCCCTGCAGC No data
Right 929572271 2:43030126-43030148 TGTCCATCCTCCCCACCTCAGGG No data
929572256_929572271 30 Left 929572256 2:43030073-43030095 CCTCCTGCCAGCTCAGTCCCTGC No data
Right 929572271 2:43030126-43030148 TGTCCATCCTCCCCACCTCAGGG No data
929572264_929572271 5 Left 929572264 2:43030098-43030120 CCACACTGGCCCTCATTGGGTTC No data
Right 929572271 2:43030126-43030148 TGTCCATCCTCCCCACCTCAGGG No data
929572260_929572271 13 Left 929572260 2:43030090-43030112 CCCTGCAGCCACACTGGCCCTCA No data
Right 929572271 2:43030126-43030148 TGTCCATCCTCCCCACCTCAGGG No data
929572261_929572271 12 Left 929572261 2:43030091-43030113 CCTGCAGCCACACTGGCCCTCAT No data
Right 929572271 2:43030126-43030148 TGTCCATCCTCCCCACCTCAGGG No data
929572267_929572271 -5 Left 929572267 2:43030108-43030130 CCTCATTGGGTTCCCTGGTGTCC No data
Right 929572271 2:43030126-43030148 TGTCCATCCTCCCCACCTCAGGG No data
929572266_929572271 -4 Left 929572266 2:43030107-43030129 CCCTCATTGGGTTCCCTGGTGTC No data
Right 929572271 2:43030126-43030148 TGTCCATCCTCCCCACCTCAGGG No data
929572258_929572271 23 Left 929572258 2:43030080-43030102 CCAGCTCAGTCCCTGCAGCCACA No data
Right 929572271 2:43030126-43030148 TGTCCATCCTCCCCACCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929572271 Original CRISPR TGTCCATCCTCCCCACCTCA GGG Intergenic