ID: 929573896

View in Genome Browser
Species Human (GRCh38)
Location 2:43040275-43040297
Sequence TCTCCCCACTGGTGGCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929573896_929573904 9 Left 929573896 2:43040275-43040297 CCACCACGCCACCAGTGGGGAGA No data
Right 929573904 2:43040307-43040329 CTAGAAGGCTCTGGTGGATTTGG No data
929573896_929573911 27 Left 929573896 2:43040275-43040297 CCACCACGCCACCAGTGGGGAGA No data
Right 929573911 2:43040325-43040347 TTTGGGTGATGAGGGGGAGAGGG No data
929573896_929573900 -6 Left 929573896 2:43040275-43040297 CCACCACGCCACCAGTGGGGAGA No data
Right 929573900 2:43040292-43040314 GGGAGAATGCTTCCTCTAGAAGG No data
929573896_929573912 28 Left 929573896 2:43040275-43040297 CCACCACGCCACCAGTGGGGAGA No data
Right 929573912 2:43040326-43040348 TTGGGTGATGAGGGGGAGAGGGG No data
929573896_929573909 21 Left 929573896 2:43040275-43040297 CCACCACGCCACCAGTGGGGAGA No data
Right 929573909 2:43040319-43040341 GGTGGATTTGGGTGATGAGGGGG No data
929573896_929573907 19 Left 929573896 2:43040275-43040297 CCACCACGCCACCAGTGGGGAGA No data
Right 929573907 2:43040317-43040339 CTGGTGGATTTGGGTGATGAGGG No data
929573896_929573901 0 Left 929573896 2:43040275-43040297 CCACCACGCCACCAGTGGGGAGA No data
Right 929573901 2:43040298-43040320 ATGCTTCCTCTAGAAGGCTCTGG No data
929573896_929573908 20 Left 929573896 2:43040275-43040297 CCACCACGCCACCAGTGGGGAGA No data
Right 929573908 2:43040318-43040340 TGGTGGATTTGGGTGATGAGGGG No data
929573896_929573910 26 Left 929573896 2:43040275-43040297 CCACCACGCCACCAGTGGGGAGA No data
Right 929573910 2:43040324-43040346 ATTTGGGTGATGAGGGGGAGAGG No data
929573896_929573905 10 Left 929573896 2:43040275-43040297 CCACCACGCCACCAGTGGGGAGA No data
Right 929573905 2:43040308-43040330 TAGAAGGCTCTGGTGGATTTGGG No data
929573896_929573902 3 Left 929573896 2:43040275-43040297 CCACCACGCCACCAGTGGGGAGA No data
Right 929573902 2:43040301-43040323 CTTCCTCTAGAAGGCTCTGGTGG No data
929573896_929573906 18 Left 929573896 2:43040275-43040297 CCACCACGCCACCAGTGGGGAGA No data
Right 929573906 2:43040316-43040338 TCTGGTGGATTTGGGTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929573896 Original CRISPR TCTCCCCACTGGTGGCGTGG TGG (reversed) Intergenic