ID: 929578736

View in Genome Browser
Species Human (GRCh38)
Location 2:43068673-43068695
Sequence TACCGGCTCCACGCCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929578734_929578736 15 Left 929578734 2:43068635-43068657 CCTGTGACATGGACAACATTTAT No data
Right 929578736 2:43068673-43068695 TACCGGCTCCACGCCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929578736 Original CRISPR TACCGGCTCCACGCCCAGCC TGG Intergenic
No off target data available for this crispr