ID: 929581802

View in Genome Browser
Species Human (GRCh38)
Location 2:43086054-43086076
Sequence GTGTGTGCACGTGTGTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929581802_929581811 13 Left 929581802 2:43086054-43086076 CCCCACCACACACGTGCACACAC No data
Right 929581811 2:43086090-43086112 TTCTCCTTGGCCTAACGCTGGGG No data
929581802_929581812 16 Left 929581802 2:43086054-43086076 CCCCACCACACACGTGCACACAC No data
Right 929581812 2:43086093-43086115 TCCTTGGCCTAACGCTGGGGAGG No data
929581802_929581814 17 Left 929581802 2:43086054-43086076 CCCCACCACACACGTGCACACAC No data
Right 929581814 2:43086094-43086116 CCTTGGCCTAACGCTGGGGAGGG No data
929581802_929581808 0 Left 929581802 2:43086054-43086076 CCCCACCACACACGTGCACACAC No data
Right 929581808 2:43086077-43086099 CACAGGCTCTGCGTTCTCCTTGG No data
929581802_929581809 11 Left 929581802 2:43086054-43086076 CCCCACCACACACGTGCACACAC No data
Right 929581809 2:43086088-43086110 CGTTCTCCTTGGCCTAACGCTGG No data
929581802_929581810 12 Left 929581802 2:43086054-43086076 CCCCACCACACACGTGCACACAC No data
Right 929581810 2:43086089-43086111 GTTCTCCTTGGCCTAACGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929581802 Original CRISPR GTGTGTGCACGTGTGTGGTG GGG (reversed) Intergenic
No off target data available for this crispr