ID: 929584468

View in Genome Browser
Species Human (GRCh38)
Location 2:43105171-43105193
Sequence CAGGTCTCCATGGTAGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929584468_929584480 7 Left 929584468 2:43105171-43105193 CCTGTTGCTACCATGGAGACCTG No data
Right 929584480 2:43105201-43105223 GGTCAGCCCTGGGAAGGGTTGGG No data
929584468_929584486 30 Left 929584468 2:43105171-43105193 CCTGTTGCTACCATGGAGACCTG No data
Right 929584486 2:43105224-43105246 TGCATTCCTGGCCATAGGGATGG No data
929584468_929584484 25 Left 929584468 2:43105171-43105193 CCTGTTGCTACCATGGAGACCTG No data
Right 929584484 2:43105219-43105241 TTGGGTGCATTCCTGGCCATAGG No data
929584468_929584476 2 Left 929584468 2:43105171-43105193 CCTGTTGCTACCATGGAGACCTG No data
Right 929584476 2:43105196-43105218 CCCCAGGTCAGCCCTGGGAAGGG No data
929584468_929584474 1 Left 929584468 2:43105171-43105193 CCTGTTGCTACCATGGAGACCTG No data
Right 929584474 2:43105195-43105217 GCCCCAGGTCAGCCCTGGGAAGG No data
929584468_929584472 -4 Left 929584468 2:43105171-43105193 CCTGTTGCTACCATGGAGACCTG No data
Right 929584472 2:43105190-43105212 CCTGAGCCCCAGGTCAGCCCTGG No data
929584468_929584483 18 Left 929584468 2:43105171-43105193 CCTGTTGCTACCATGGAGACCTG No data
Right 929584483 2:43105212-43105234 GGAAGGGTTGGGTGCATTCCTGG No data
929584468_929584479 6 Left 929584468 2:43105171-43105193 CCTGTTGCTACCATGGAGACCTG No data
Right 929584479 2:43105200-43105222 AGGTCAGCCCTGGGAAGGGTTGG No data
929584468_929584485 26 Left 929584468 2:43105171-43105193 CCTGTTGCTACCATGGAGACCTG No data
Right 929584485 2:43105220-43105242 TGGGTGCATTCCTGGCCATAGGG No data
929584468_929584473 -3 Left 929584468 2:43105171-43105193 CCTGTTGCTACCATGGAGACCTG No data
Right 929584473 2:43105191-43105213 CTGAGCCCCAGGTCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929584468 Original CRISPR CAGGTCTCCATGGTAGCAAC AGG (reversed) Intergenic
No off target data available for this crispr