ID: 929585472

View in Genome Browser
Species Human (GRCh38)
Location 2:43111316-43111338
Sequence AATGAAAACCCTACTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929585472_929585476 8 Left 929585472 2:43111316-43111338 CCACACCCAGTAGGGTTTTCATT No data
Right 929585476 2:43111347-43111369 TAATAGTTCTTATTTATTGTGGG No data
929585472_929585475 7 Left 929585472 2:43111316-43111338 CCACACCCAGTAGGGTTTTCATT No data
Right 929585475 2:43111346-43111368 ATAATAGTTCTTATTTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929585472 Original CRISPR AATGAAAACCCTACTGGGTG TGG (reversed) Intergenic
No off target data available for this crispr