ID: 929585580

View in Genome Browser
Species Human (GRCh38)
Location 2:43112192-43112214
Sequence CAAGCTCAAGACACTCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929585573_929585580 25 Left 929585573 2:43112144-43112166 CCAGGTTAAACAAAGGCTGCACA No data
Right 929585580 2:43112192-43112214 CAAGCTCAAGACACTCCTGTGGG No data
929585572_929585580 26 Left 929585572 2:43112143-43112165 CCCAGGTTAAACAAAGGCTGCAC No data
Right 929585580 2:43112192-43112214 CAAGCTCAAGACACTCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929585580 Original CRISPR CAAGCTCAAGACACTCCTGT GGG Intergenic
No off target data available for this crispr