ID: 929586861

View in Genome Browser
Species Human (GRCh38)
Location 2:43121784-43121806
Sequence CTTCCATCCCATCTGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929586861_929586867 1 Left 929586861 2:43121784-43121806 CCTGGTTCCAGATGGGATGGAAG No data
Right 929586867 2:43121808-43121830 AGAGGAGAGAGAGGGAGTTCAGG No data
929586861_929586866 -7 Left 929586861 2:43121784-43121806 CCTGGTTCCAGATGGGATGGAAG No data
Right 929586866 2:43121800-43121822 ATGGAAGGAGAGGAGAGAGAGGG No data
929586861_929586869 8 Left 929586861 2:43121784-43121806 CCTGGTTCCAGATGGGATGGAAG No data
Right 929586869 2:43121815-43121837 AGAGAGGGAGTTCAGGAAGGAGG No data
929586861_929586865 -8 Left 929586861 2:43121784-43121806 CCTGGTTCCAGATGGGATGGAAG No data
Right 929586865 2:43121799-43121821 GATGGAAGGAGAGGAGAGAGAGG No data
929586861_929586870 15 Left 929586861 2:43121784-43121806 CCTGGTTCCAGATGGGATGGAAG No data
Right 929586870 2:43121822-43121844 GAGTTCAGGAAGGAGGCAAAAGG No data
929586861_929586868 5 Left 929586861 2:43121784-43121806 CCTGGTTCCAGATGGGATGGAAG No data
Right 929586868 2:43121812-43121834 GAGAGAGAGGGAGTTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929586861 Original CRISPR CTTCCATCCCATCTGGAACC AGG (reversed) Intergenic
No off target data available for this crispr