ID: 929593196

View in Genome Browser
Species Human (GRCh38)
Location 2:43160067-43160089
Sequence AGGGAGGAGAAAAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929593196_929593203 -3 Left 929593196 2:43160067-43160089 CCCTCCTCCTTTTTCTCCTCCCT No data
Right 929593203 2:43160087-43160109 CCTCCTACTCACCCACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929593196 Original CRISPR AGGGAGGAGAAAAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr