ID: 929594773

View in Genome Browser
Species Human (GRCh38)
Location 2:43169291-43169313
Sequence GTGGTGGGAGGGAGGTTTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929594759_929594773 28 Left 929594759 2:43169240-43169262 CCAGGGCAGTGTCTGGGAAGGGA No data
Right 929594773 2:43169291-43169313 GTGGTGGGAGGGAGGTTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929594773 Original CRISPR GTGGTGGGAGGGAGGTTTCG GGG Intergenic
No off target data available for this crispr