ID: 929594943

View in Genome Browser
Species Human (GRCh38)
Location 2:43170055-43170077
Sequence CCTTTTCTTTGGAGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929594943_929594954 3 Left 929594943 2:43170055-43170077 CCTCCCAGCCTCCAAAGAAAAGG No data
Right 929594954 2:43170081-43170103 AGTTGAGGCCTCCTTGGGGGTGG No data
929594943_929594952 -1 Left 929594943 2:43170055-43170077 CCTCCCAGCCTCCAAAGAAAAGG No data
Right 929594952 2:43170077-43170099 GTTCAGTTGAGGCCTCCTTGGGG No data
929594943_929594955 4 Left 929594943 2:43170055-43170077 CCTCCCAGCCTCCAAAGAAAAGG No data
Right 929594955 2:43170082-43170104 GTTGAGGCCTCCTTGGGGGTGGG No data
929594943_929594956 9 Left 929594943 2:43170055-43170077 CCTCCCAGCCTCCAAAGAAAAGG No data
Right 929594956 2:43170087-43170109 GGCCTCCTTGGGGGTGGGTGCGG No data
929594943_929594953 0 Left 929594943 2:43170055-43170077 CCTCCCAGCCTCCAAAGAAAAGG No data
Right 929594953 2:43170078-43170100 TTCAGTTGAGGCCTCCTTGGGGG No data
929594943_929594960 17 Left 929594943 2:43170055-43170077 CCTCCCAGCCTCCAAAGAAAAGG No data
Right 929594960 2:43170095-43170117 TGGGGGTGGGTGCGGGTCCTTGG No data
929594943_929594963 30 Left 929594943 2:43170055-43170077 CCTCCCAGCCTCCAAAGAAAAGG No data
Right 929594963 2:43170108-43170130 GGGTCCTTGGGCCATCTCTAGGG No data
929594943_929594951 -2 Left 929594943 2:43170055-43170077 CCTCCCAGCCTCCAAAGAAAAGG No data
Right 929594951 2:43170076-43170098 GGTTCAGTTGAGGCCTCCTTGGG No data
929594943_929594961 18 Left 929594943 2:43170055-43170077 CCTCCCAGCCTCCAAAGAAAAGG No data
Right 929594961 2:43170096-43170118 GGGGGTGGGTGCGGGTCCTTGGG No data
929594943_929594957 10 Left 929594943 2:43170055-43170077 CCTCCCAGCCTCCAAAGAAAAGG No data
Right 929594957 2:43170088-43170110 GCCTCCTTGGGGGTGGGTGCGGG No data
929594943_929594962 29 Left 929594943 2:43170055-43170077 CCTCCCAGCCTCCAAAGAAAAGG No data
Right 929594962 2:43170107-43170129 CGGGTCCTTGGGCCATCTCTAGG No data
929594943_929594950 -3 Left 929594943 2:43170055-43170077 CCTCCCAGCCTCCAAAGAAAAGG No data
Right 929594950 2:43170075-43170097 AGGTTCAGTTGAGGCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929594943 Original CRISPR CCTTTTCTTTGGAGGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr