ID: 929595896

View in Genome Browser
Species Human (GRCh38)
Location 2:43175633-43175655
Sequence CAGGGGCAAGAGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929595889_929595896 23 Left 929595889 2:43175587-43175609 CCTGTGGGAAATGTACATATGAA No data
Right 929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG No data
929595888_929595896 29 Left 929595888 2:43175581-43175603 CCTGGTCCTGTGGGAAATGTACA No data
Right 929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929595896 Original CRISPR CAGGGGCAAGAGAAGGATGG AGG Intergenic
No off target data available for this crispr