ID: 929597964

View in Genome Browser
Species Human (GRCh38)
Location 2:43187863-43187885
Sequence AGTGGCTATTCTAGACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929597964_929597971 13 Left 929597964 2:43187863-43187885 CCATCCAGTCTAGAATAGCCACT No data
Right 929597971 2:43187899-43187921 ATTCTTTTTTTCCTTGAGACAGG No data
929597964_929597972 14 Left 929597964 2:43187863-43187885 CCATCCAGTCTAGAATAGCCACT No data
Right 929597972 2:43187900-43187922 TTCTTTTTTTCCTTGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929597964 Original CRISPR AGTGGCTATTCTAGACTGGA TGG (reversed) Intergenic
No off target data available for this crispr