ID: 929599056

View in Genome Browser
Species Human (GRCh38)
Location 2:43193701-43193723
Sequence CTCCCTAAGTGGGGCTTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929599056_929599064 29 Left 929599056 2:43193701-43193723 CCCCTAAAGCCCCACTTAGGGAG No data
Right 929599064 2:43193753-43193775 ATGAATTAAAACAAACTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929599056 Original CRISPR CTCCCTAAGTGGGGCTTTAG GGG (reversed) Intergenic
No off target data available for this crispr