ID: 929604095

View in Genome Browser
Species Human (GRCh38)
Location 2:43224221-43224243
Sequence TGCTGGGGGCACGGGAGTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 754
Summary {0: 1, 1: 0, 2: 1, 3: 66, 4: 686}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929604095_929604108 -6 Left 929604095 2:43224221-43224243 CCCCCACTCCCGTGCCCCCAGCA 0: 1
1: 0
2: 1
3: 66
4: 686
Right 929604108 2:43224238-43224260 CCAGCAAGGGCGAGATGGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 222
929604095_929604109 -5 Left 929604095 2:43224221-43224243 CCCCCACTCCCGTGCCCCCAGCA 0: 1
1: 0
2: 1
3: 66
4: 686
Right 929604109 2:43224239-43224261 CAGCAAGGGCGAGATGGCGAGGG 0: 1
1: 0
2: 0
3: 13
4: 151
929604095_929604110 -4 Left 929604095 2:43224221-43224243 CCCCCACTCCCGTGCCCCCAGCA 0: 1
1: 0
2: 1
3: 66
4: 686
Right 929604110 2:43224240-43224262 AGCAAGGGCGAGATGGCGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929604095 Original CRISPR TGCTGGGGGCACGGGAGTGG GGG (reversed) Exonic
900127124 1:1073611-1073633 TCCTGGGTGCAGGGGAGGGGCGG - Intronic
900177921 1:1298900-1298922 AGCTGGGGGCCCGAGAGTGCCGG + Intronic
900234688 1:1582530-1582552 TCCTGGGGGAAAGGGAGAGGTGG - Intergenic
900432809 1:2611066-2611088 TGCTGGAGGCTGGGGACTGGGGG + Intronic
900483332 1:2909951-2909973 TGCAGGGGGCCCGTGAGTGCAGG + Intergenic
900483360 1:2910036-2910058 TGCAGGGGGCCCGTGAGTGCAGG + Intergenic
900483377 1:2910104-2910126 TGCAGGAGGCACGTGAGTGCAGG + Intergenic
900542994 1:3213352-3213374 TGCTGGGGAGAGGGGTGTGGGGG + Intronic
900621946 1:3591598-3591620 TGATGGGGGCGCGGGCGAGGGGG + Intronic
900790482 1:4676617-4676639 TGATGGGGGGACGGGAGTGAGGG + Intronic
901020442 1:6252552-6252574 TGCTGGGGGTGGGGCAGTGGGGG + Intronic
901422302 1:9159244-9159266 TCCTGGGGACACGAGGGTGGTGG - Intergenic
901650775 1:10741980-10742002 GGCTGGGGGCACGTGAGAAGCGG - Intronic
901871619 1:12141898-12141920 GGCTGGGGACCCAGGAGTGGGGG + Intronic
902080996 1:13820651-13820673 TCCTGGGGTCCTGGGAGTGGGGG + Intronic
902092684 1:13916006-13916028 GGTTGGGGGCCGGGGAGTGGGGG + Intergenic
902272288 1:15313318-15313340 TGCTGGGGGCGGGGTGGTGGGGG + Intronic
902280724 1:15372219-15372241 TGGTGGGGACATGGGGGTGGGGG + Intronic
903006474 1:20302235-20302257 TGGTGGGGGCAGGGGGTTGGGGG - Intronic
903027668 1:20441191-20441213 AGCTGGGGGCTCGGGAGAGGTGG - Intergenic
903165862 1:21519951-21519973 TGCTGGGAACGCAGGAGTGGTGG + Intronic
903576906 1:24344976-24344998 TGGAGGGGGCACAGGTGTGGAGG - Intronic
903576982 1:24345227-24345249 TGGAGGGGGCACAGGTGTGGAGG - Intronic
903576988 1:24345244-24345266 TGGAGGGGGCACAGGTGTGGAGG - Intronic
904618953 1:31764152-31764174 TGCTCGGGGCGGGGGAGCGGGGG - Intronic
904703799 1:32375421-32375443 TGGTGGGGGGACTGGAGGGGGGG + Intronic
905095676 1:35468468-35468490 AGCTGGGGGAAAGGGACTGGAGG - Intronic
905133501 1:35779649-35779671 TTGGGGGGGCAGGGGAGTGGGGG - Intergenic
905280658 1:36846964-36846986 TCCTGGAGGCAGGGGAATGGAGG - Intronic
906544885 1:46613782-46613804 TGCTGGGGGCAGGGTGGAGGGGG + Intronic
906678646 1:47710251-47710273 TGCTGAGTACACGGGGGTGGGGG + Intergenic
906733013 1:48099314-48099336 CGGGGAGGGCACGGGAGTGGGGG + Intergenic
906836944 1:49094217-49094239 TGGTGGGGGTAGGGGAGTGGGGG - Intronic
907303024 1:53500060-53500082 TGCTGGGGGCACAGGAGACCCGG - Intergenic
907441606 1:54481965-54481987 TGTTGGAGGCACGGGTGGGGCGG - Intergenic
907603813 1:55795404-55795426 TGGTGGGGGCAGGGGGGTGGGGG + Intergenic
907604921 1:55806783-55806805 TGCTGGGGCTAGGGGAGAGGTGG - Intergenic
908148057 1:61268397-61268419 GGGTGGGGGCAGGGGAGTAGAGG - Intronic
909902956 1:81160858-81160880 TGCTGGGGGATGGGGAGGGGTGG - Intergenic
910326005 1:86007797-86007819 TGCTGAGGGCAGGGAAGAGGAGG + Intronic
911158710 1:94661185-94661207 TGCTGGGGCCATGTGAGAGGAGG + Intergenic
912701680 1:111882630-111882652 TGCAGGGGGCGAGGGTGTGGGGG + Intronic
912723365 1:112038544-112038566 TGCTGGGTTCAAGGCAGTGGAGG - Intergenic
912763203 1:112386679-112386701 TGCGGGGGGCAATGGGGTGGGGG + Intergenic
913451752 1:118997551-118997573 TGCTGGGGGCAGGTGGGAGGGGG - Intergenic
915059789 1:153171897-153171919 TTCGGGGGGCATGGGAGGGGAGG - Intergenic
915163160 1:153933587-153933609 TGCGGGAGGCAGGGGAGTGGCGG + Exonic
915278828 1:154808480-154808502 TGCTGAGGACAAGGGTGTGGAGG - Intronic
915526527 1:156479645-156479667 TGCTGGGGGGACAGGAGCCGCGG + Exonic
916160127 1:161903107-161903129 TGCTAGGGGCAAGGAAGTGGTGG - Intronic
918337157 1:183528350-183528372 TTCTGGGGGGAGGGGAATGGTGG - Intronic
919951275 1:202365988-202366010 TTGTGGGGGGGCGGGAGTGGAGG - Intronic
920403668 1:205693347-205693369 TGCAGGGAGCAGGGCAGTGGTGG + Intergenic
920501603 1:206488676-206488698 TGCTTGGGGCCTGGGAGAGGAGG - Intronic
920951926 1:210580486-210580508 TGCTGGGGGGTGGGGGGTGGGGG - Intronic
921002124 1:211055193-211055215 TGCTGGGGATAGGGGAGGGGTGG - Intronic
921175274 1:212587940-212587962 TGCTGGGGCGGCGGGGGTGGGGG + Intronic
921218718 1:212958296-212958318 AGCTGGGGGCAGGGCAGTGGCGG - Intronic
922437746 1:225622960-225622982 TGGTGGGGGTGCTGGAGTGGAGG - Intronic
922504281 1:226117693-226117715 TGCTGGGGGCTGGGGAAGGGAGG - Intergenic
922689820 1:227679500-227679522 AGCAGGGGGTACGTGAGTGGGGG - Intergenic
922958572 1:229625857-229625879 TGCCGGGAGCACGGGCGGGGAGG - Intronic
924648640 1:245903614-245903636 TGCTGGGGGTCAGGGAGAGGTGG - Intronic
924939355 1:248802004-248802026 TGCTGTGGGCAGAGGAGTGGAGG + Intergenic
1062857211 10:785309-785331 TGCTGCGGGCAGGGGGCTGGGGG - Intergenic
1063074260 10:2699428-2699450 GGCTGGGGGCAGGGGAGCAGGGG + Intergenic
1063566630 10:7177064-7177086 TGCTGGGGGGACTGGAGAGCAGG - Intronic
1063580270 10:7300161-7300183 TGCTGGGGGATGGGGAGTGGAGG + Intronic
1064022927 10:11823751-11823773 TCCTGGGGGCTCAGGGGTGGAGG + Intronic
1064125050 10:12652203-12652225 AGATGGGGGCAAGGGAGTGGAGG - Intronic
1064225812 10:13483819-13483841 TGCTGGGGGTACGGGAGGAAGGG + Intronic
1064612906 10:17122406-17122428 AGCTGGGGACACTGGTGTGGTGG + Intronic
1064996611 10:21301923-21301945 TGGAGGGGGGATGGGAGTGGAGG - Intergenic
1065599739 10:27356540-27356562 TGCTGGGGGCAGTGCAGTTGTGG + Intergenic
1066372316 10:34827912-34827934 TTGTGGGGGCGGGGGAGTGGTGG - Intergenic
1066381863 10:34908625-34908647 TGCTGGGGGATCGGCAGAGGAGG - Intergenic
1067087546 10:43250833-43250855 GGCTGGAGGCTTGGGAGTGGTGG + Intronic
1067226804 10:44382103-44382125 TCCTGGGGACAAGGAAGTGGGGG - Intronic
1067416347 10:46106217-46106239 AGCTGGGGCCAGGGGAGCGGGGG + Intergenic
1068511270 10:57968626-57968648 GGCTGGGGGCAAGGAAGTGTGGG + Intergenic
1068652140 10:59534197-59534219 TGTTGGGGGGTGGGGAGTGGGGG + Intergenic
1068721897 10:60254844-60254866 TGCTGGGTGACCAGGAGTGGTGG + Intronic
1068969181 10:62945299-62945321 TGCTGAGGGCCTGGGAGTGGGGG - Intergenic
1069591782 10:69646387-69646409 TGCTGGGGGCTGGGGGCTGGGGG + Intergenic
1069824657 10:71247653-71247675 TGCTGGGGCCTGGGGACTGGGGG - Intronic
1069947654 10:71998895-71998917 TACTGGGTGCAGGGGGGTGGAGG + Intronic
1069957926 10:72062978-72063000 TGCTGGGGGCCCAGGCCTGGGGG - Intronic
1070534490 10:77365317-77365339 TGCTGAAGGCTTGGGAGTGGAGG - Intronic
1070761217 10:79025434-79025456 TGTTGGCGGCACAGGAGTGGGGG + Intergenic
1070804753 10:79264529-79264551 TGCTGGCGGCAGGGCAATGGCGG - Intronic
1071524989 10:86353450-86353472 TTCTGGGGGCTCTGGTGTGGTGG - Intronic
1071819516 10:89265207-89265229 TGCAGGGGGTTGGGGAGTGGGGG + Intronic
1071869879 10:89781831-89781853 TGCTGGGGGTGCGGGAAGGGTGG + Intergenic
1072161757 10:92773744-92773766 TGTTGGAGGTAGGGGAGTGGAGG - Intergenic
1072924622 10:99606063-99606085 AGATGGGGGCACTGGAGTAGAGG - Intergenic
1073083939 10:100876597-100876619 TGGTGGGGGCACGGGTGGGATGG - Intergenic
1073099884 10:101000776-101000798 TGCTGGGGGCTGGGGTGTGTGGG + Exonic
1073150174 10:101306023-101306045 TGTTGGGGGGACTCGAGTGGGGG + Intergenic
1073221792 10:101880647-101880669 TGCTGGGGGGCCGGGGGTTGTGG - Intronic
1073289891 10:102408412-102408434 TGCTGGGGGCGGTGGAGTGGGGG - Intronic
1073431775 10:103491831-103491853 TGGTGTGGGCAGGGGAATGGGGG - Intergenic
1074843224 10:117375250-117375272 CGCTGTGGGCGCGGGAGTAGGGG - Exonic
1075077642 10:119361629-119361651 TGCTGGGTGCCCGGCAGTGGGGG + Intronic
1075396252 10:122129815-122129837 TTCTGGGGGAACTGGAATGGTGG + Intronic
1075587622 10:123668995-123669017 TCCTGGGGTCTCAGGAGTGGAGG + Intronic
1075919755 10:126200856-126200878 TGATGGGGGCAGGGTGGTGGTGG + Intronic
1076545786 10:131245004-131245026 TGCTGGGCACAGGGGAGTGGGGG + Intronic
1076892964 10:133293802-133293824 CTGTGGGGGCATGGGAGTGGGGG - Intronic
1077047954 11:554539-554561 TCCCGCGGGCACGGGGGTGGGGG + Exonic
1077055612 11:591238-591260 TGCTGGCAACACGGCAGTGGAGG - Intronic
1077104475 11:836188-836210 TGATGGTGGCCCGGGAGGGGTGG - Intronic
1077156904 11:1096089-1096111 TGTTGGGGTCACCGTAGTGGTGG - Intergenic
1077191656 11:1258241-1258263 TGCTGGGGGTGGGGGAGTGCAGG + Intronic
1077303970 11:1859702-1859724 TGCTGGGGGCTGGGGGCTGGGGG - Intronic
1077316289 11:1920811-1920833 TGCTGGGGGCAGGGGTGTGCTGG - Intronic
1077509334 11:2948039-2948061 AGCTGGTGGCATGGGAGGGGTGG + Intronic
1077916008 11:6611997-6612019 TGCTGGGGGCACGGGACCCTTGG - Exonic
1078190433 11:9089591-9089613 GGCTGGGGGAAAGGGAGAGGAGG + Intronic
1078290381 11:10004998-10005020 TGGTGGTGGCATGGGGGTGGGGG - Intronic
1078756330 11:14214322-14214344 TACTTGGGGCCAGGGAGTGGAGG - Intronic
1078929635 11:15903281-15903303 TGCTGGGTGCAGTGGAGTAGTGG + Intergenic
1079019505 11:16897505-16897527 GGCTGGGAGCAGGGGACTGGTGG + Intronic
1079116479 11:17643518-17643540 TGGTGGGGGCCCAGGGGTGGGGG + Intronic
1081521003 11:43880952-43880974 TGCTGGGTGCGCGGGGCTGGGGG + Exonic
1081670382 11:44939062-44939084 TGCTGGCGGTGGGGGAGTGGGGG - Intronic
1081979933 11:47259894-47259916 TGCTGGGGGTACTGCAGGGGTGG + Exonic
1082997815 11:59266995-59267017 TGATGGGGGCCTGGGGGTGGGGG - Intergenic
1083429371 11:62606030-62606052 GGCTGGGGTCAAGGGAGTGAGGG - Intronic
1083761040 11:64817914-64817936 TGCGGGGGAGACAGGAGTGGTGG + Intergenic
1084466693 11:69327540-69327562 TTCTTGGGGGCCGGGAGTGGTGG - Intronic
1084477873 11:69399054-69399076 TGCTGTGGGCACGTGAGGGGTGG - Intergenic
1084758076 11:71251766-71251788 TGGTGCGGGCCCGGGGGTGGCGG - Intronic
1084810190 11:71607382-71607404 TGCTGGGGCCACGGGATGCGGGG - Intergenic
1084814823 11:71639800-71639822 TGCCGGGGGCGCGGGGGTGCCGG + Intergenic
1084859945 11:72011788-72011810 AGATGGGGGCGGGGGAGTGGGGG - Intronic
1085050062 11:73375810-73375832 TGCGGGGAGTAGGGGAGTGGAGG + Intergenic
1085427014 11:76413672-76413694 TGCTGGGTCCAGGGGAGGGGAGG - Intronic
1085514135 11:77102622-77102644 TTCTGCGGGGACTGGAGTGGAGG + Intronic
1086572530 11:88302022-88302044 CGCTGGGGGCTGGTGAGTGGAGG - Intronic
1087667298 11:101065685-101065707 TGCAGCGGGCAGGGGAGTGGGGG - Intronic
1088939645 11:114439968-114439990 GGCTTGGGTCACTGGAGTGGGGG + Intronic
1089340344 11:117752990-117753012 GGGTGGGAGCACGGGAGTGGTGG + Intronic
1089554341 11:119307431-119307453 TGATGGGGGCTGGGGGGTGGGGG - Exonic
1089589149 11:119529460-119529482 TGCTGTGGGGAAGGGAGAGGAGG - Intergenic
1089722142 11:120435801-120435823 AGCTTGGGGGCCGGGAGTGGTGG - Intronic
1089948471 11:122502653-122502675 TGCCAGGGGCTGGGGAGTGGAGG - Intergenic
1089973191 11:122710848-122710870 TCCTGGGGGCAGGGTGGTGGGGG + Intronic
1090125146 11:124076440-124076462 TGCTGCGGGAGCGGCAGTGGCGG - Intergenic
1090334804 11:125955094-125955116 TGCAGCAGGCACGGGAATGGTGG + Intergenic
1090415666 11:126538604-126538626 TGCTCGGGGAACAGGATTGGGGG + Intronic
1090976304 11:131683353-131683375 TGCAGGGTGCACGGGAGGAGGGG + Intronic
1091172334 11:133530082-133530104 AGATGGGGGCAGGGGGGTGGGGG + Intronic
1091311281 11:134576933-134576955 AGCTCAGGGCAGGGGAGTGGGGG + Intergenic
1091343438 11:134837432-134837454 TGCTAGGGGCACTGTGGTGGTGG + Intergenic
1091400260 12:176952-176974 AGCTGTGGGGATGGGAGTGGAGG + Exonic
1091668783 12:2437925-2437947 TGGTGGTGGCAGTGGAGTGGTGG + Intronic
1091803597 12:3340949-3340971 TGCCAGGGGCACTGCAGTGGGGG + Intergenic
1092441554 12:8509160-8509182 TGCTGGGGGCTCAGGTGGGGAGG + Intergenic
1092654994 12:10674465-10674487 TACTGAAGGGACGGGAGTGGTGG + Intergenic
1096489777 12:52007153-52007175 CGCTGGGGGCCCAGGGGTGGCGG - Exonic
1096747603 12:53738803-53738825 TGGTGGGCGCCAGGGAGTGGGGG - Intergenic
1096843298 12:54391630-54391652 TGGGGTGGGCAGGGGAGTGGGGG + Intergenic
1097714969 12:62956030-62956052 TGCAGGGGATAGGGGAGTGGTGG + Intergenic
1099584797 12:84503199-84503221 TCCTGGGTGTACTGGAGTGGGGG + Intergenic
1100945181 12:99774980-99775002 TGCCAGGGGCTGGGGAGTGGAGG + Intronic
1101416023 12:104508911-104508933 TGGTGGTGGCGCGGCAGTGGTGG - Intronic
1101428138 12:104604516-104604538 TGCTGTGGGCCAGGGAGTTGAGG + Intronic
1101673627 12:106898494-106898516 GGGTGGGGGAAGGGGAGTGGAGG + Intergenic
1102004913 12:109582957-109582979 TGCTGGGGGCTGGGGCGGGGTGG - Intronic
1102050150 12:109856216-109856238 TGCTGAGGGCTGGGGAGTGGAGG - Intronic
1102205099 12:111084869-111084891 TGCGGGGTGCAGGGGATTGGAGG + Intronic
1102219998 12:111187815-111187837 TGCTGGGGGCAGGGGTGATGGGG + Intronic
1102957438 12:117068240-117068262 TGCTGAGGGCCTGGGTGTGGTGG + Intronic
1104410792 12:128556062-128556084 TGCTGGAGGCATTGGGGTGGTGG + Intronic
1104844345 12:131839215-131839237 TCCTGGAGACACGGGAGAGGAGG - Intronic
1105589958 13:21783228-21783250 AGCTGGGGGTAAGGGAGTGAGGG + Intergenic
1106673977 13:31937569-31937591 TGGTGGAGGGACGGGAGTGGGGG - Intergenic
1107654263 13:42575008-42575030 TGCTGGGGCCACGGTGCTGGAGG + Intronic
1108624247 13:52211677-52211699 TGCTGGGGGGAAGGGATGGGAGG + Intergenic
1108661801 13:52594745-52594767 TGCTGGGGGGAAGGGATGGGAGG - Intergenic
1109878814 13:68443688-68443710 TGCTGGGGTCATGGGATTGAGGG - Intergenic
1109973633 13:69802675-69802697 AGCAGGGGGTACGGGACTGGGGG - Intronic
1111040910 13:82746199-82746221 GGCTGGGGGAGCGGGGGTGGGGG + Intergenic
1111240434 13:85466302-85466324 TGCTGGGTGGGGGGGAGTGGGGG + Intergenic
1111949802 13:94701652-94701674 TGCTAGGGACAGGGGAGGGGCGG + Intergenic
1112352958 13:98651884-98651906 TGCCAAGGGCACGGGAGTTGAGG - Intergenic
1112464364 13:99630480-99630502 AGTTGGGGGCAGGGGAGTGCTGG + Intronic
1113062061 13:106332639-106332661 TGTTGGGGGCAGGGGGGCGGTGG - Intergenic
1113116802 13:106882746-106882768 TGCTGGGAGGGCTGGAGTGGTGG + Intergenic
1114834173 14:26184013-26184035 TGTTGGGGCCGGGGGAGTGGGGG - Intergenic
1115490658 14:33954892-33954914 TGCTAGGGGCTTGGGAGAGGAGG - Intronic
1115762046 14:36584463-36584485 CGCTGGGGGCTCGGGAGCTGAGG - Intergenic
1116368020 14:44093332-44093354 TGCTGCGGGCAGCGGAGCGGGGG + Intergenic
1116725275 14:48554788-48554810 TGCTGGGGGTGTGGGAGGGGTGG + Intergenic
1118056879 14:62087932-62087954 TGCTGGGGGCTGTGCAGTGGAGG - Intronic
1119541212 14:75439246-75439268 TGCTGGGGGCTTGGCTGTGGTGG + Intronic
1119723411 14:76906973-76906995 TGCTGGGGGCAGGTGAGAGTAGG + Intergenic
1119729917 14:76944698-76944720 GGCTGGGGGCAGGGGCGAGGGGG - Intergenic
1119748578 14:77061840-77061862 TGCAGGTGGGGCGGGAGTGGGGG + Intergenic
1120208943 14:81615526-81615548 GGGTGGGGGCAGGGGAGCGGGGG - Intergenic
1120401966 14:84043479-84043501 TGCTGGGGTTAAGGGGGTGGGGG + Intergenic
1120546987 14:85824192-85824214 TGCCTGGGGCTGGGGAGTGGGGG + Intergenic
1120747483 14:88165383-88165405 GGCTGGGGGGAGGGGAGTGCTGG + Intergenic
1120765956 14:88326604-88326626 TGCTGGGGGCCGGCGAGTGCAGG - Intronic
1120815395 14:88851694-88851716 GGCTGGGGGCAGGGTGGTGGGGG + Intronic
1121006650 14:90495070-90495092 TGCTGGGGACACAAGAGTGAGGG + Intergenic
1121323192 14:93004780-93004802 TGCGGGGGGCACAGGGTTGGGGG + Intronic
1121442234 14:93956507-93956529 TGCTGGGGGCATCTGAGGGGGGG + Intronic
1121541727 14:94732805-94732827 TGTTGGGGGCGAGGGAGTGAAGG - Intergenic
1121779013 14:96609624-96609646 GGCTGGGGGCTCGGGAGTGAGGG - Intergenic
1122210127 14:100168188-100168210 TGTTGGGGGCAGGGGTGTGTGGG - Intergenic
1122378689 14:101286332-101286354 GGCCGAGGGCAGGGGAGTGGCGG + Intergenic
1122455594 14:101848243-101848265 TGTTGGGGGGCCGGGCGTGGTGG + Intronic
1122480249 14:102042554-102042576 TGCTGTCGGCACGTGTGTGGTGG + Intronic
1122745060 14:103892565-103892587 TGCTGGGGAGACAGGAGTGAGGG + Intergenic
1122769535 14:104091846-104091868 TGCTGGAGGCCCTGGAGGGGTGG + Intronic
1122819325 14:104333328-104333350 TGCTGGAGGTAGGGGTGTGGAGG - Intergenic
1122822537 14:104354791-104354813 TGCTGGGGGCAGGGGGCTGGGGG + Intergenic
1122822545 14:104354805-104354827 GGCTGGGGGCAGGGGGCTGGGGG + Intergenic
1122822557 14:104354826-104354848 GGCTGGGGGCAGGGGGCTGGGGG + Intergenic
1122822573 14:104354854-104354876 GGCTGGGGGCAGGGGGCTGGGGG + Intergenic
1122828423 14:104383528-104383550 AGCTGGTGGCCCAGGAGTGGGGG + Intergenic
1123053801 14:105560013-105560035 TGCTTGGGCCACGGGCCTGGGGG + Intergenic
1123078384 14:105680430-105680452 TGCTTGGGCCACGGGCCTGGGGG + Intergenic
1124027715 15:25982171-25982193 AGCAGGGGGCACGTGACTGGGGG + Intergenic
1124216724 15:27813314-27813336 TGCTGGGGTCAGGAGGGTGGAGG - Intronic
1124427881 15:29577913-29577935 TGCTAGGGGCAGAGGGGTGGTGG + Intergenic
1124469294 15:29968876-29968898 TGCGGCGGGCGCGGGAGCGGTGG - Intergenic
1124619360 15:31265160-31265182 TGCTGGGCTCCAGGGAGTGGAGG + Intergenic
1125519065 15:40338280-40338302 TGATGGTGGCATGGGAGTTGGGG - Intronic
1125520828 15:40347020-40347042 CGCAGGAGGCAGGGGAGTGGCGG + Intergenic
1125602021 15:40920689-40920711 GGGTGGGGGCACGGGCGCGGTGG - Intergenic
1126099949 15:45112959-45112981 TTCTGGGGGCCCGGGCGTGCTGG - Intronic
1126517741 15:49554655-49554677 TGCTGGGGGTTGGGGAGGGGTGG + Intronic
1126651095 15:50922036-50922058 TTCTGGGGGCCTGGGTGTGGTGG + Intronic
1127097531 15:55527494-55527516 TGCTGGGGGCCCAGGTCTGGAGG + Intergenic
1127673767 15:61220927-61220949 TGTTTGGGGCTGGGGAGTGGGGG - Intronic
1127843110 15:62847252-62847274 TGCTGGGCGCATGGGACTGAGGG - Intergenic
1127910411 15:63411629-63411651 AGCTGGGGGCCCAGGGGTGGGGG + Intergenic
1128547790 15:68579339-68579361 TGCGGGGGGCGCGGGGGTGTGGG + Intronic
1128577086 15:68783681-68783703 TGCTGGTGGCAAGGGAGAAGGGG + Intronic
1128989864 15:72250815-72250837 GGCTGGGGGCTGGGCAGTGGGGG - Intronic
1129457178 15:75682250-75682272 GGCTGGGGGCATCTGAGTGGTGG + Intronic
1129674304 15:77624273-77624295 AGCTGGGGGCCGGGGAGTGGGGG - Intronic
1130718977 15:86367464-86367486 TGCTGGGGGCAGGGTGGTGGTGG + Intronic
1131147206 15:90021721-90021743 TGCTGGGGGCAGGGGGCTGTAGG + Intronic
1131150657 15:90045538-90045560 TGCAGGAGGCCAGGGAGTGGTGG + Intronic
1132394052 15:101459456-101459478 GGGTGGGGGGACGGGAATGGTGG - Intronic
1132561618 16:597232-597254 TGCTGGGGGGCCTGGAGTTGTGG + Intronic
1132590884 16:726028-726050 TCCTGGGGGCACCGCAGTGTGGG - Exonic
1132652141 16:1026128-1026150 TGGCGGGGGCTGGGGAGTGGTGG + Intergenic
1132744138 16:1429708-1429730 AGCTGGGGGCTCGGGACAGGGGG + Intergenic
1132793589 16:1706951-1706973 GGCTGGGGGCACGGAGGAGGGGG - Intronic
1132851246 16:2026001-2026023 GGCTGTGGGCAGGGGAGGGGAGG + Intronic
1132888107 16:2191244-2191266 AGCTGAGGGCAGGGGAGTTGAGG + Intronic
1132934909 16:2475256-2475278 TGCTGGGGGCGGGAGCGTGGGGG + Intronic
1133230121 16:4362445-4362467 TCCTGGGGGCTGGGGTGTGGTGG - Intronic
1133231430 16:4368866-4368888 TGCTGGGGGCACAGGCTGGGAGG + Intronic
1133370061 16:5240136-5240158 TGCCGGGGGCGCGGGGGTGCCGG + Intergenic
1133786746 16:8979832-8979854 TGGCGGGGGCAGGGGGGTGGTGG - Intergenic
1133809934 16:9154136-9154158 TGCTGGGGGCCCTGGAGTCTAGG - Intergenic
1133981037 16:10633482-10633504 TCCTGGGTGCAGGAGAGTGGGGG - Intronic
1134827214 16:17294447-17294469 TGCTTGTGGCATGAGAGTGGCGG - Intronic
1135087679 16:19488050-19488072 TGATTAGGGCAGGGGAGTGGTGG + Intronic
1136234271 16:28904634-28904656 GGCTGGGGGCAGGGGAGGGCTGG + Exonic
1136385826 16:29925580-29925602 TGCTGGGGGTAAAGGATTGGGGG + Intronic
1136418314 16:30116846-30116868 GGCTGGGGGCAGGGGAGCAGGGG - Intronic
1137943144 16:52708616-52708638 GGGTGGGGGGAAGGGAGTGGAGG + Intergenic
1138542197 16:57695227-57695249 TGGTGGGGGTGGGGGAGTGGTGG - Intronic
1138547241 16:57727235-57727257 TGCTGGGGTTACAGGAGTGGAGG + Intronic
1139230876 16:65281327-65281349 TGCTGGGGGAAAGGAAGGGGAGG - Intergenic
1139290525 16:65854235-65854257 TGGTGGGAGCAGAGGAGTGGTGG + Intergenic
1139347609 16:66314335-66314357 TGCTGTGGGCATGGCACTGGGGG - Intergenic
1140253966 16:73319082-73319104 TGCTGAGGGGAGGGGAGGGGAGG + Intergenic
1140455578 16:75103508-75103530 GGCGGGGGGAAGGGGAGTGGTGG + Intronic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1141443271 16:84042839-84042861 TGCAGGGGGCTGGGGAGAGGCGG - Intergenic
1141683527 16:85557211-85557233 CCCAGGGGGCACAGGAGTGGGGG - Intergenic
1141742945 16:85906331-85906353 TGCTGGCGGCAGGGGTGGGGGGG + Intronic
1141787275 16:86210006-86210028 AGCTGGGGGCTGGGGAGAGGTGG - Intergenic
1141991998 16:87615807-87615829 TGCTAGGGGGAGGCGAGTGGGGG + Intronic
1142259486 16:89036177-89036199 AGCTGGGGGCCTGGGGGTGGGGG - Intergenic
1142419592 16:89962130-89962152 GGCTGGGGCCATGGAAGTGGGGG + Intronic
1142670177 17:1484455-1484477 TGCTGAGGGCCTGGGTGTGGTGG + Intronic
1142759247 17:2033847-2033869 GGCTTGGGGCACTGGAGAGGAGG + Intronic
1142882770 17:2894489-2894511 AGCTGAGGCCACGGGAGGGGTGG - Intronic
1143202094 17:5120268-5120290 TGGTGGGGGCAAGGCAGTGGTGG + Intronic
1143473679 17:7191517-7191539 TGCGGGTGGCAGGGGGGTGGGGG - Intronic
1144519187 17:15943052-15943074 TGCTGTGGGAACGTGATTGGTGG + Intergenic
1144668886 17:17120317-17120339 TGCTTGGGCCAGGGGTGTGGTGG + Intronic
1144778635 17:17797058-17797080 TGCTGGGGGCAGCCCAGTGGGGG + Exonic
1146638134 17:34520999-34521021 TGCTGGCAGGAGGGGAGTGGTGG - Intergenic
1146649868 17:34599961-34599983 TGCTGGGGGCCCTGGTGGGGAGG + Intronic
1147240971 17:39090365-39090387 TCCTAGTGGCATGGGAGTGGGGG - Intronic
1147257705 17:39191932-39191954 TGCTGGGGGCAGGGGAGGGAAGG - Intronic
1147314226 17:39611944-39611966 TCCTGGGGGCAGGGGTGAGGGGG + Intergenic
1147317484 17:39627709-39627731 GGCTGGGGGTGCGGGGGTGGGGG + Intronic
1147426104 17:40346631-40346653 TGCTGGGGGGGCGGGGTTGGGGG - Intronic
1147581466 17:41629566-41629588 TGGTGGGGGCAAGGCAGTGGTGG - Intergenic
1147864960 17:43546028-43546050 TGGAGGGGGCGCGGGAGTTGTGG - Intronic
1147998632 17:44375165-44375187 TCCTGGGGGTAAGGGGGTGGGGG - Intronic
1148026550 17:44593010-44593032 TTCTGGGGGCTTGAGAGTGGAGG + Intergenic
1148237262 17:45977155-45977177 TGCTGAGGGCATGGGAGGGCGGG - Intronic
1148605830 17:48928225-48928247 AGCTGGGGGCACGGGGGAGGCGG - Exonic
1148843200 17:50512339-50512361 TGCTGGGGGGCCGGGCGCGGTGG - Intronic
1149703164 17:58672321-58672343 TGCTGGGGAAATGGGAGTAGAGG - Intronic
1149888228 17:60362146-60362168 TGCTGGGGGAACAGAAGTAGTGG - Intronic
1149987536 17:61358992-61359014 TGCAGGGGGCACAGGAGAGTAGG - Intronic
1150216959 17:63476552-63476574 TGCCGGGGGTAGGGGTGTGGCGG - Intergenic
1150287899 17:63964290-63964312 TGCTGGTGGCAGGGGGATGGAGG - Intronic
1150598198 17:66626002-66626024 TGCTGGGGGCAGAGTGGTGGTGG - Intronic
1151116471 17:71740968-71740990 AGCTGGGGGAAGGGGAGAGGGGG - Intergenic
1151704995 17:75762794-75762816 CGCTGGAGGCCAGGGAGTGGCGG + Exonic
1151723910 17:75873968-75873990 TGCTGGGAAAAAGGGAGTGGGGG + Intergenic
1151955343 17:77377305-77377327 TGGTGGAGGCACGGGGCTGGCGG + Intronic
1152040118 17:77897651-77897673 TGGTGGGGGGAGGGGAGCGGAGG - Intergenic
1152058739 17:78052561-78052583 TGCGGGGGCCACTGGAGTTGGGG + Intronic
1152269917 17:79318344-79318366 TGCTGGGGGCAGAGGAGCTGGGG + Intronic
1152522711 17:80868932-80868954 TGCTGGGGGCAGGTGAGGGTGGG + Intronic
1153399454 18:4667131-4667153 TGCTGGTGGCATGGGGCTGGTGG - Intergenic
1153481956 18:5555861-5555883 GGCTGGGCCGACGGGAGTGGAGG - Intronic
1155072744 18:22330557-22330579 TGCTGGGGGGACAGGAATGATGG - Intergenic
1155443274 18:25884356-25884378 TGCTGGGGGCTGGGGAGGGGTGG - Intergenic
1155504610 18:26521073-26521095 TGCTGGGGGAGTGGGAGTGAAGG + Intronic
1156149872 18:34228437-34228459 GGGTGGGGGCAGGGGGGTGGAGG - Intergenic
1156859701 18:41821635-41821657 TGGCGGGGGCAAGGGGGTGGTGG - Intergenic
1157355741 18:46932196-46932218 TGCTAGTGGGACGGGCGTGGTGG - Intronic
1157363751 18:47044317-47044339 GGCTGGGGGCAGGGGAGATGTGG + Intronic
1157508179 18:48246789-48246811 TGTTGGGGGCATGGGATGGGGGG - Intronic
1158432206 18:57399640-57399662 TGCTGGGGCAACAGGGGTGGAGG - Intergenic
1160223735 18:76996693-76996715 AGCTGGGGGGCAGGGAGTGGAGG + Intronic
1160602378 18:80023510-80023532 TGCTGGTTGCATGGGGGTGGGGG - Intronic
1160699502 19:499017-499039 CGCTGTGGGCAGGGGAGGGGTGG - Intronic
1160723870 19:609058-609080 TGCTCGGGGCGCGGGAGAGGGGG - Intronic
1160745099 19:707756-707778 GGGTGGGGGCAGGGGGGTGGGGG + Intergenic
1161138234 19:2633307-2633329 TGCTGGGGGCAGGGGACATGGGG - Intronic
1161285399 19:3465874-3465896 TGCACGGGGCAGGGGAGAGGGGG - Intronic
1161499629 19:4606879-4606901 TGGTGGGGGGGCGGGGGTGGGGG - Intergenic
1161512537 19:4679589-4679611 TGCTGGAAGCACGGGATCGGGGG - Intronic
1161591379 19:5130765-5130787 TTCTGGGGTCACGGGAGGTGAGG - Intronic
1161725089 19:5923998-5924020 TGCTGGGGGCAGCGTAGTGTTGG - Intronic
1161845159 19:6707931-6707953 TGCGGGGGGCATAGGGGTGGCGG + Intronic
1161928341 19:7318169-7318191 TGCCAGGGGCTGGGGAGTGGGGG - Intergenic
1161977342 19:7613758-7613780 TGCTGGGGGCGAGGGGGTGAAGG - Intronic
1162141121 19:8586171-8586193 TGCTGTGGGCACTGCAGTAGTGG + Exonic
1162760515 19:12885860-12885882 TGCTGGCGGCCCGGGGCTGGTGG - Exonic
1162914175 19:13865458-13865480 GGCCGGGGGCACGGGCGGGGCGG + Intronic
1163190484 19:15673422-15673444 TGCTGGGGGCAGGGCAGGGAGGG - Intronic
1163747984 19:19059341-19059363 TGCTGGGGGCAGGGGAGACGGGG - Intronic
1163916508 19:20245132-20245154 TGCTGTGGGCTCAGAAGTGGGGG - Intergenic
1164305578 19:24002396-24002418 CGCTGGGGGCAGGGAAGGGGTGG + Intergenic
1164462496 19:28461166-28461188 TGGTGGGGGCAGGGGAGTGCTGG - Intergenic
1164469064 19:28513244-28513266 TGCTTGGGTCAGGAGAGTGGAGG + Intergenic
1165117098 19:33535146-33535168 TGCTGGGGGCAGGGGAGGGAAGG + Intergenic
1165177833 19:33943076-33943098 AGTTGGGGGCAGGGGAGTGACGG - Intergenic
1165786434 19:38464618-38464640 TCCTGGGGGTGGGGGAGTGGAGG - Exonic
1165827983 19:38716484-38716506 TGGCGGGGGCATGGGAGTGGAGG + Intronic
1165861618 19:38912087-38912109 TGCTGGGGGCGGGTGAGTGCGGG - Exonic
1165950715 19:39472760-39472782 TGCTGTGGGCACAGCCGTGGGGG + Intronic
1166538710 19:43592172-43592194 TGCTGGGGGCGCAGCACTGGGGG - Exonic
1166705135 19:44904259-44904281 TCCTGGAGGCTCGGGAGTCGTGG - Intergenic
1166856329 19:45784202-45784224 GGCTGGGGGCATGGGGTTGGGGG + Exonic
1167145901 19:47680763-47680785 CGCTGTGGGCCCCGGAGTGGGGG - Exonic
1167449022 19:49556285-49556307 TGCTGGGGGAAGGGGAGGGGTGG + Intronic
1167468569 19:49663087-49663109 GGCTGGAGGCAGGGGAGTGGGGG + Intronic
1167507096 19:49876592-49876614 GGCTACGGGCACGTGAGTGGAGG - Exonic
1167557260 19:50203999-50204021 TGCTGGGGGCGGGGGACTGGAGG - Intronic
1167597511 19:50435376-50435398 GGCTGGGAGCACGGGAGGCGTGG - Intronic
1167648884 19:50719268-50719290 GGCTGGGGGTACGGGTGAGGTGG - Intronic
1167745819 19:51351272-51351294 TGCTGGGGTCACTGGGCTGGTGG + Intronic
1168244651 19:55105979-55106001 TGCTGGGTGCAAGGGGCTGGCGG - Intronic
1168602012 19:57726077-57726099 GGGTGGGGGCGGGGGAGTGGGGG - Intronic
1168659794 19:58156999-58157021 TGCTGGGTGAACGTGGGTGGCGG - Intergenic
925041967 2:739516-739538 TGCAGGAGGCAGGGGAATGGGGG + Intergenic
925255590 2:2484139-2484161 TGCTGGGGGCAGGCTACTGGAGG - Intergenic
925368415 2:3326437-3326459 TGGTGGGAGCAGGGCAGTGGAGG - Intronic
925611458 2:5706026-5706048 AGCTGGGGGGACCGGGGTGGAGG + Intergenic
925917537 2:8617385-8617407 TCCTGGAGACACAGGAGTGGGGG - Intergenic
926109107 2:10170796-10170818 GGCTGGGGGCGGGGGCGTGGGGG - Intronic
927035363 2:19169602-19169624 TGCTGGGGGCAGAGGGGAGGGGG - Intergenic
927812751 2:26189133-26189155 TGATGGGGGCAAGAGATTGGCGG - Exonic
927875059 2:26649762-26649784 TGCTGGGGGCCCGGGGCTTGGGG + Intergenic
927970769 2:27305163-27305185 TTCTGGGGTCCTGGGAGTGGTGG + Intronic
928446730 2:31339584-31339606 TGCTAGGGCCACGGGTGTGCAGG + Exonic
928599677 2:32892002-32892024 TGCTAGGGGCTGGGGAGTGGTGG + Intergenic
929255264 2:39803805-39803827 TGCTGGGGCCAGGGAGGTGGGGG - Intergenic
929558118 2:42938042-42938064 TGTTGGTGGCGTGGGAGTGGGGG - Intergenic
929604095 2:43224221-43224243 TGCTGGGGGCACGGGAGTGGGGG - Exonic
930060921 2:47287773-47287795 TGCCAGGGGCCAGGGAGTGGGGG + Intergenic
930755620 2:54969028-54969050 TGCTGGGGGAAAGGGACAGGTGG + Intronic
931429549 2:62197202-62197224 GGCTGCGGGCGCGGGACTGGCGG + Intronic
931625289 2:64251633-64251655 TGCTGGGGGCCTGAGTGTGGAGG + Intergenic
932316095 2:70784203-70784225 TGGTGGGGGCAGGGCAGGGGTGG - Intronic
932823857 2:74922980-74923002 TGATGGTGGCAGGGGAGAGGGGG - Intergenic
933354728 2:81197012-81197034 AGCAGTGGGCACGGGCGTGGAGG + Intergenic
933722715 2:85408622-85408644 TGCTGGGGGCTTGGCACTGGGGG + Intronic
934563257 2:95323909-95323931 TCCTGAGGGCAGGGGAGGGGAGG + Intronic
934620138 2:95798648-95798670 TGGTAGGGGCACGGGAGTGTGGG + Intergenic
934978896 2:98824282-98824304 GGTTGGGGGCAGGGGGGTGGGGG - Intronic
935135874 2:100301280-100301302 TGGTGGGGGCAGGGGAAGGGTGG + Intronic
935160749 2:100527544-100527566 TGATGGGGGCAGGGGGGCGGTGG - Intergenic
935240239 2:101171603-101171625 TGGTGGGGGGGCGGGGGTGGTGG - Intronic
935783170 2:106525633-106525655 TGCTAGGGACAGGGGAGAGGAGG - Intergenic
935949098 2:108312650-108312672 TGTTGGGGGGAGGGGACTGGTGG + Intergenic
935971026 2:108531255-108531277 AGCAGGGGGTACGTGAGTGGAGG - Intergenic
936042596 2:109161196-109161218 TCCTGGGGGCAGGTGAGAGGTGG + Intronic
936139847 2:109929909-109929931 TGCTGGTGTCTCTGGAGTGGAGG - Intergenic
936139866 2:109930020-109930042 TGCTGGTGTCTCTGGAGTGGAGG - Intergenic
936204830 2:110441466-110441488 TGCTGGTGTCTCTGGAGTGGAGG + Intronic
936204849 2:110441577-110441599 TGCTGGTGTCTCTGGAGTGGAGG + Intronic
937218928 2:120330303-120330325 TGCTGTCGGCAGGGGTGTGGGGG + Intergenic
937277933 2:120697771-120697793 TGCTGGGGGCTGGGGAGATGGGG + Intergenic
937876813 2:126832236-126832258 TGCTGAGGTCATGGGAGTGAAGG + Intergenic
937990136 2:127657561-127657583 TGCTGGGGGCAGGAGACAGGAGG + Exonic
938093554 2:128447990-128448012 TGGTGGGGGCAGGTGGGTGGTGG + Intergenic
938619120 2:133031231-133031253 TGCTGGGGGTAGGGGAGGGATGG - Intronic
938682079 2:133702255-133702277 TTCTGAGGGAAAGGGAGTGGAGG + Intergenic
939054580 2:137348740-137348762 TACTAGGGGCATGGGAGTGGAGG + Intronic
940272780 2:151909565-151909587 TGCTGGGGGTTGGGGAGTGAGGG - Intronic
940499907 2:154480986-154481008 AGGTGGGGCCACAGGAGTGGGGG - Intergenic
941459756 2:165755360-165755382 TGCTGTGGGCAAAGGAATGGTGG + Intronic
942017963 2:171836140-171836162 AGGTGAGGGCAGGGGAGTGGGGG + Intronic
943676435 2:190720292-190720314 TCCTGGGGGCAGGTGAGAGGAGG + Intergenic
945042108 2:205751178-205751200 TGTTGGGGGACCTGGAGTGGGGG + Intronic
945723935 2:213451963-213451985 AGCTGGAAGCGCGGGAGTGGAGG - Intronic
945936117 2:215904401-215904423 TGCTGGAGGCAGGGGACTTGGGG - Intergenic
946029599 2:216693912-216693934 GTCTGGAGGCACGGGGGTGGAGG + Intronic
946167417 2:217873465-217873487 TGCTGTGGGAACAGGGGTGGGGG + Intronic
946304404 2:218847546-218847568 TTCTGGGGATAGGGGAGTGGGGG - Intergenic
946405851 2:219491738-219491760 TCCTGGTGGCAGGGAAGTGGGGG - Intronic
947496859 2:230643938-230643960 GGCAGGGGACACGGGAGCGGGGG + Intergenic
947674091 2:231961772-231961794 TGCAGGGGGCAGGCGAGTGAGGG - Intronic
947993279 2:234504425-234504447 TGGTGGGGGCAAGGGTGAGGGGG - Intergenic
948538827 2:238670476-238670498 GGCTGGGGGCAGGGGAATGGGGG - Intergenic
948606733 2:239140726-239140748 TGGTGGGGGCCCTGGAGGGGAGG + Intronic
948687214 2:239676877-239676899 TGGGGGGTGCACGTGAGTGGGGG - Intergenic
948689244 2:239691546-239691568 TGCTGGGCACACGGCAGGGGAGG + Intergenic
948805971 2:240453546-240453568 TGCGGCAGGCACGGGGGTGGGGG - Intronic
949077742 2:242071852-242071874 TGCTGGAGTCACTGGAGTGCTGG - Intergenic
1169029844 20:2398566-2398588 TGCTTGGGGCAGGGAGGTGGGGG - Intronic
1171173813 20:23036567-23036589 TCCTGCTGGCAGGGGAGTGGGGG - Exonic
1171333167 20:24359139-24359161 TCCTGGCAGCACAGGAGTGGCGG + Intergenic
1171421547 20:25021013-25021035 GGCTGGGGACACAGAAGTGGCGG + Intronic
1172600085 20:36177428-36177450 GGCTGTGGGGAAGGGAGTGGTGG + Intronic
1172754034 20:37270939-37270961 AGCTGGGGGCCTGGGTGTGGAGG - Intergenic
1172766210 20:37352397-37352419 TTCTGTGGGGAAGGGAGTGGGGG + Intronic
1173182646 20:40816358-40816380 AGCTGGGGGTGAGGGAGTGGGGG - Intergenic
1173790385 20:45824266-45824288 CGCTGGGGGCCCGGGAGCCGAGG - Intronic
1173820761 20:46018837-46018859 AGCTCGGGGCAGGGGAGAGGAGG - Intergenic
1173839972 20:46150923-46150945 GGGTGGGGGTATGGGAGTGGAGG + Intergenic
1173969059 20:47137034-47137056 TGCTGGGGGCTAAGGGGTGGGGG - Intronic
1174168731 20:48603494-48603516 TGTTGGGGGCAGGGGGCTGGGGG - Intergenic
1174338738 20:49883010-49883032 TGGTGGGGGGAGGGGGGTGGGGG - Intronic
1174726256 20:52865458-52865480 TGCTGAGGGAACTGGAGAGGGGG - Intergenic
1174799830 20:53553922-53553944 TGATGGGGGCAGTGGAGGGGGGG + Intergenic
1175392093 20:58633912-58633934 TGCTAGGAGCATGGGAGGGGAGG + Intergenic
1175537200 20:59722824-59722846 CGGTGGGGGCATGGGGGTGGTGG + Intronic
1175699908 20:61129413-61129435 TGCTGGGTGCAGGGGACTTGCGG - Intergenic
1175816407 20:61885293-61885315 AGCTGGGGGTAAGGGAGTCGAGG - Intronic
1175957952 20:62621146-62621168 TGGGGGAGGCACGGGAGGGGTGG - Intergenic
1176019339 20:62954569-62954591 TGCTGGGGGCGCGGGGGACGGGG - Intronic
1176088750 20:63309734-63309756 TGCTGGAGTAGCGGGAGTGGGGG - Intronic
1177770046 21:25504047-25504069 GGCAGGAGGCATGGGAGTGGTGG - Intergenic
1177823411 21:26056549-26056571 TGTTGGGGGCAGGGGGGTGGTGG - Intronic
1178028646 21:28498066-28498088 TGCTGGGGGGTCGGGGGAGGTGG - Intergenic
1179054177 21:37916210-37916232 CGCTGGGGCCAAGGGAGGGGCGG + Exonic
1179190192 21:39116809-39116831 TGCTGGGGTCATGGAAGTGGAGG - Intergenic
1179511577 21:41877303-41877325 TGTTCTGGGCAGGGGAGTGGAGG - Intronic
1179960157 21:44763634-44763656 TGCTGGGTGTCCGGGTGTGGTGG - Intergenic
1179960203 21:44763789-44763811 TGCTGGGTGCCCGGGTGTGCTGG - Intergenic
1179960324 21:44764188-44764210 TGCTGGGTGCCCGGGTGTGCTGG - Intergenic
1179960352 21:44764274-44764296 TGCTGGGTGCCCGGGTGTGCTGG - Intergenic
1179970833 21:44836118-44836140 TGGTGGGGTCAGGGGTGTGGTGG - Intergenic
1179970900 21:44836255-44836277 TGGTGGGGTCAGGGGTGTGGTGG - Intergenic
1180919904 22:19516297-19516319 TGCTGTGGGTACGGGAGGGCAGG + Intronic
1182031462 22:27162463-27162485 TGCTGGGGAAACAGGAGTGTGGG - Intergenic
1182323140 22:29491322-29491344 GGCTGGGGGCAGGGCAGGGGAGG + Exonic
1182488578 22:30654576-30654598 GGCTGGGGACCCGGAAGTGGTGG + Intronic
1182766214 22:32760083-32760105 GGCTGGGGGCACGTGGGTGCTGG - Intronic
1183041048 22:35178272-35178294 TTCTGGGGACACGGCAGTAGAGG - Intergenic
1183302442 22:37064964-37064986 TGCTGGGGCCACAGGGGTGAAGG - Intergenic
1183455763 22:37922299-37922321 TCCTGGGGGCAGGGGTGGGGCGG - Exonic
1183485195 22:38084624-38084646 TGCTCGGGTCAGGGGAGAGGTGG - Intergenic
1183530013 22:38348248-38348270 TGCTGATGGCACGGGGGTGACGG + Intronic
1183605772 22:38866124-38866146 GGCTGGGGGCAAGGGTGGGGTGG + Exonic
1183939178 22:41283221-41283243 GGTTGGGGGGCCGGGAGTGGTGG + Intronic
1184060728 22:42079559-42079581 TGGTGGCGTCACGAGAGTGGCGG - Intergenic
1184315163 22:43682143-43682165 TGGTGGGGGGATGGGAGGGGAGG + Intronic
1184523165 22:45007617-45007639 TGCTGGGGGCACCGCTGTGGCGG - Intronic
1184629279 22:45763199-45763221 TTCTGGGGGCAGGGAGGTGGTGG + Intronic
1184730504 22:46368799-46368821 TGCTGAGGCCACTGGAGGGGAGG - Intronic
949467347 3:4357552-4357574 TGGTTGGGGCAGGGGTGTGGTGG - Intronic
949534770 3:4987167-4987189 TGCTGGGCGCGAGGGAGGGGGGG - Intergenic
949903748 3:8840982-8841004 AGCAGGGGGCAAGGGAGTGAGGG + Intronic
949970001 3:9396755-9396777 TGCGCGGGGCGCGGGGGTGGCGG - Intergenic
950125288 3:10506624-10506646 TGGAGGGGGCAGGGCAGTGGAGG - Intronic
950663777 3:14482673-14482695 TGCTGGTGGCAGGGGAGGGAGGG + Intronic
951542844 3:23798569-23798591 TGCTGGGGGTTGGGGGGTGGCGG + Intergenic
951643018 3:24856892-24856914 TGATGGGGGCAGGGGGATGGAGG + Intergenic
952764959 3:36945490-36945512 GGCTGGGGGTCCGGGAGTGAAGG + Intergenic
952935186 3:38392085-38392107 TGCTGAGTGTAAGGGAGTGGAGG + Intronic
954715581 3:52525142-52525164 TGCTGGGGGCGGGGGGGGGGGGG + Intronic
955056472 3:55459993-55460015 TGCTGGGGGCATGTTTGTGGAGG + Intergenic
955252744 3:57300914-57300936 TGCTGGGGGGAGGGCAGAGGGGG + Intronic
956357838 3:68413739-68413761 TGTTGGGGGCAGGGGGGTGAGGG + Intronic
956669155 3:71670416-71670438 GGCTGGGGCCACGGGGGTTGGGG - Intergenic
957072868 3:75579925-75579947 TGCCGGGGGCGCGGGGGTGCTGG - Intergenic
957699392 3:83689060-83689082 TGTTGGGGGGAGGGGAGGGGAGG - Intergenic
958617492 3:96514599-96514621 AGCTGGGGATAGGGGAGTGGTGG - Intergenic
959041203 3:101424644-101424666 TGATGTTGGCACGGGTGTGGTGG - Intronic
959849666 3:111071770-111071792 TGCCGAGGGGAGGGGAGTGGCGG + Exonic
961327774 3:126119526-126119548 GCCTGGAGGCAGGGGAGTGGTGG - Intronic
961536541 3:127574131-127574153 AGCAGGGGTCACAGGAGTGGGGG - Intronic
962688252 3:137868209-137868231 TGCTGGGGGTCAGGGAGGGGTGG - Intergenic
962883925 3:139605457-139605479 TGCTGGGAGCAGGGGAGTTCTGG + Intronic
963039595 3:141059035-141059057 GGCTGGGGGCACAGAAGTGCTGG + Intronic
963168337 3:142226954-142226976 TGCTGGTGGCAGTGGAGAGGTGG - Intergenic
963395756 3:144731289-144731311 TTTTGGGGGCGGGGGAGTGGGGG + Intergenic
966246039 3:177809001-177809023 TCCTCTGGGCACGGGGGTGGGGG + Intergenic
966799486 3:183749435-183749457 TGCTGGGGGGGCGGGAGGAGTGG - Intronic
967888927 3:194351364-194351386 CGCTGGGGCCACGTGAGGGGAGG - Intergenic
968728668 4:2259804-2259826 TCCTGGGGTCACGGGAATGCTGG - Intronic
968750356 4:2385792-2385814 AGCTGGGAGCACTGGAGTGGGGG - Intronic
968854839 4:3111950-3111972 TGCTGGGGACAGGGGAGGGTAGG - Intronic
968947126 4:3670940-3670962 TGCCGGGGGCACAGGAGCAGTGG - Intergenic
969016476 4:4107227-4107249 TGCCGGGGGCGCGGGGGTGATGG - Intergenic
969259043 4:6022145-6022167 TCCTGGGGGCTGAGGAGTGGAGG - Intergenic
969543911 4:7811512-7811534 TGGTGGGGGCACCAGGGTGGAGG - Intronic
969549141 4:7852812-7852834 TGGTGGGGGCCTGGGAGAGGGGG - Intronic
969868211 4:10089012-10089034 TGCTGGGGGCACCTCACTGGGGG - Intronic
970279609 4:14439924-14439946 TGCTGGAGGCAAGGGGATGGAGG + Intergenic
970392630 4:15631061-15631083 TGGTGGGGGTAGGGGACTGGGGG - Intronic
973905093 4:55520787-55520809 TGCTGGAGGCAGGGGATGGGAGG - Intronic
974003211 4:56531039-56531061 TGCGGGGCTCACGGGTGTGGCGG - Exonic
974055769 4:56981249-56981271 GGGTGGGGACACGGGAGGGGGGG - Intronic
974548959 4:63348638-63348660 GGCTGGGGGGATGGGGGTGGGGG + Intergenic
974558970 4:63492718-63492740 TGCTGGGGGAAGGAGAGAGGGGG - Intergenic
975297636 4:72751920-72751942 TGCTGGGGGCAAGGGGGCAGGGG + Intergenic
975971730 4:80047561-80047583 TGTTGGGGGCAAGGGAGAGAGGG - Intronic
976822470 4:89222059-89222081 TGCCAGGGGTAAGGGAGTGGGGG - Intergenic
977471767 4:97452123-97452145 TGCTGGGGGCGGGGGGGGGGGGG - Intronic
978471900 4:109077428-109077450 TGTTGGGGGCGGGGGGGTGGTGG - Intronic
979693686 4:123587610-123587632 TTCTGGGGGCAGGTGGGTGGGGG + Intergenic
979978066 4:127221449-127221471 TGTTGGGGGCTGGGGAGTGAAGG - Intergenic
980114936 4:128670216-128670238 TGCTGGGTGGCCGGGCGTGGTGG - Intergenic
980919972 4:139074477-139074499 TGCAGGGGGGCCGGGTGTGGTGG + Intronic
981530929 4:145753005-145753027 TGCTGGGGGCTGGGGAGGGATGG + Intronic
984377710 4:178953787-178953809 TGGTGGCGGCACGGTGGTGGTGG - Intergenic
984914303 4:184707360-184707382 TGCAGGGGGCAGGGGAGCGGGGG - Intronic
985491978 5:185652-185674 TGCTGGGGGCCCAGGTGTGCAGG + Exonic
985592071 5:770786-770808 TGCTGGGGGCACCGGTGTCAGGG + Intergenic
985643576 5:1074743-1074765 TTCTGGGGGCAGGTGAGTTGGGG + Intronic
986337465 5:6766266-6766288 TGGTGTGGGCAGGGGATTGGTGG + Intergenic
990185697 5:53206779-53206801 AGCTGGGGGCCAGGAAGTGGTGG - Intergenic
990333015 5:54745913-54745935 TGCTGGGGCCAAGGGAGGGGAGG - Intergenic
990785334 5:59412446-59412468 AGTTGGGAGCACTGGAGTGGGGG + Intronic
992131900 5:73701601-73701623 TGGTGGGGGGAGGGGAGTGAGGG - Intronic
992993569 5:82310443-82310465 TGCAGGCGGCATGGGGGTGGGGG - Intronic
993098578 5:83508930-83508952 TGCTGGAGGCAAGGAAGTTGAGG + Intronic
995741346 5:115358971-115358993 TGGTGGGGGATTGGGAGTGGGGG + Intergenic
996582002 5:125041504-125041526 TGCTGGGGGCGGGGGCGGGGTGG - Intergenic
997436799 5:133881511-133881533 TGATGGGGGCACAGAAGTGGGGG + Intergenic
997521028 5:134524871-134524893 TGCTGGCAGGAGGGGAGTGGAGG - Intronic
997586279 5:135045475-135045497 TGCTGGGGACTCAGGAGTGATGG + Intronic
997628785 5:135350391-135350413 GGCGGGGGTCAGGGGAGTGGGGG + Intronic
997695598 5:135858396-135858418 TTGTGGGGGCACGGCAGAGGTGG - Intronic
998160137 5:139808625-139808647 TGATGGGGGCCCGGGAGTGGAGG + Intronic
998374470 5:141681934-141681956 TGCTCGCGGGACAGGAGTGGCGG + Intronic
998462519 5:142320327-142320349 TGCTGGGGGTAGGGAGGTGGGGG - Intronic
998883761 5:146672494-146672516 TGCTGGAGACATGGGGGTGGGGG + Intronic
999240537 5:150124902-150124924 GGCCGGGGGTAGGGGAGTGGGGG - Intronic
999406736 5:151313118-151313140 TGCTGGGGGTGGGGGAGGGGTGG + Intergenic
999471211 5:151857019-151857041 AGCTGGGGGCCCGGGCCTGGCGG + Intronic
999782276 5:154858837-154858859 TGTAGGGGGAAGGGGAGTGGGGG + Intronic
1000159983 5:158587620-158587642 TGCTGGGGGTTGGGGAGGGGTGG + Intergenic
1001179142 5:169502400-169502422 TGCTGGAGGCATGGTGGTGGGGG - Intergenic
1001266566 5:170278444-170278466 GGCTGGGGGGATGGGAGTGCAGG + Intronic
1001278287 5:170366737-170366759 AGCTGGGGGCACAGGGATGGAGG + Intronic
1001588006 5:172846197-172846219 TGATGGGTGCAGGGGATTGGGGG - Intronic
1001712319 5:173788816-173788838 TGCTGGGGGTAGGGGGGTTGAGG + Intergenic
1001824880 5:174736421-174736443 TGCTGGGGGAGGGGGAGTGGAGG - Intergenic
1002203800 5:177548701-177548723 AGCTTGGGGCAAGGGAGAGGTGG + Intronic
1002313106 5:178326649-178326671 AGGTGGGGGAACGTGAGTGGAGG - Intronic
1002428101 5:179187587-179187609 TGCTGGGGGGAGGGGAGGGGAGG - Intronic
1002446985 5:179295878-179295900 TGCTGGGAGCAAGGGAGGCGTGG + Intronic
1002601109 5:180354203-180354225 TGCAGGGGGAACGGGAGGGACGG - Intergenic
1003031828 6:2607906-2607928 TGCTGGTGGCAATGGAGTAGAGG + Intergenic
1003197268 6:3926068-3926090 TCCGGGGGCCACGGGAGTCGGGG + Intergenic
1003318552 6:5033081-5033103 TCCGGGGGCCACGGGAGTGGGGG - Intergenic
1003735754 6:8876099-8876121 GGCTGGGGGCAGGGCGGTGGTGG + Intergenic
1003881370 6:10482819-10482841 TGCGGGGGACTCGGGCGTGGCGG + Intergenic
1003983946 6:11417090-11417112 TGGGGGGGGCTCGGGAATGGCGG + Intergenic
1006315823 6:33290851-33290873 TGGTGGGGGGAGGGGAGGGGAGG + Exonic
1006642861 6:35497517-35497539 GTCTGGGGCCCCGGGAGTGGGGG - Intergenic
1006923404 6:37640758-37640780 TCCTTGGGGCAGGGCAGTGGAGG + Intronic
1007257347 6:40538297-40538319 AGCTGGAGGCCCGGGAGTAGGGG - Intronic
1007398487 6:41590406-41590428 TCCTGGAGGCAGGGGTGTGGCGG - Intronic
1008177741 6:48288975-48288997 TGCTGGGGGTGGGGGAGGGGTGG + Intergenic
1008903449 6:56649572-56649594 TGATGGGGGGAGGTGAGTGGGGG + Intronic
1012145093 6:95670428-95670450 GGCTCAGGGCACGGGACTGGTGG + Intergenic
1013836939 6:114343776-114343798 TGCTGGGGGCAAAGGGTTGGAGG - Intergenic
1015559756 6:134501968-134501990 TCATGGGGGCTCGGGCGTGGTGG - Intergenic
1015683669 6:135835168-135835190 GGCGGGGGGCGGGGGAGTGGTGG + Intergenic
1016202973 6:141435028-141435050 TGTTGGGGGATGGGGAGTGGGGG + Intergenic
1016771454 6:147856810-147856832 TTCTGGGGGCGCGGGGGGGGGGG + Intergenic
1017127467 6:151079400-151079422 CACTGGGGGCAGGGCAGTGGGGG + Intronic
1017383442 6:153856904-153856926 TGCGTGTGGCACGGGACTGGCGG - Intergenic
1017604995 6:156124215-156124237 GGGTGGGGGCATGGCAGTGGCGG + Intergenic
1018742678 6:166742562-166742584 TGCGGTGGCCACGGGAGGGGAGG + Intronic
1018813784 6:167316491-167316513 TGGGGAGGGCACGGGAGTGGGGG - Intergenic
1019000373 6:168744389-168744411 GGGTGGGTGCACGGGAGGGGTGG + Intergenic
1019271291 7:150450-150472 TGCTGGGGGCACAGGAGCTCGGG - Intergenic
1019407121 7:889627-889649 TGCATGGGGCCTGGGAGTGGAGG + Intronic
1019475835 7:1243862-1243884 TGCTGGGGCCAAGGGAAGGGAGG - Intergenic
1019703816 7:2488078-2488100 GGCTGGGGGCGGGGGAGAGGGGG - Intergenic
1020278729 7:6639164-6639186 TGCTGGGGGTAGGGGGTTGGGGG - Intronic
1021271598 7:18594139-18594161 TGCTGGGGGCAGGGGTGGGGAGG - Intronic
1021497176 7:21288832-21288854 TGCTAGGGGCAGGGGAGAGTGGG + Intergenic
1022410691 7:30136287-30136309 TGCGGAGGGCAGGGGAGTCGGGG + Intronic
1022599028 7:31738994-31739016 TGTGGGGGGCAGGGGTGTGGGGG - Intergenic
1023554318 7:41404866-41404888 TGCTGGTGGCAGGGGTGTCGTGG + Intergenic
1023805408 7:43869448-43869470 TGCTGGGGCCACGGGTGAGTGGG - Exonic
1024530265 7:50385473-50385495 TGCTGGGGGAGCTGGAGGGGTGG + Intronic
1024686737 7:51754034-51754056 TGCATTGGGCAAGGGAGTGGTGG + Intergenic
1024718991 7:52113528-52113550 AGCAGGGGGCACGTGACTGGGGG - Intergenic
1024735799 7:52303019-52303041 TGGTGGGGGCAGGGAGGTGGTGG + Intergenic
1025623202 7:63193191-63193213 TGGTGGGGGCTGGGGAGAGGGGG + Intergenic
1026492444 7:70874420-70874442 TGCTGGGAGCACTGGGATGGTGG - Intergenic
1026805943 7:73429658-73429680 AGCTGGGGGCTCAGGAGTTGGGG + Intergenic
1026889610 7:73974262-73974284 TGCTGGGGGAACAGGTGGGGAGG + Intergenic
1027453358 7:78358505-78358527 CGCTGGGGGCCCAGGAATGGCGG - Intronic
1029952693 7:104603834-104603856 TGCTGGGCACACTGGGGTGGGGG + Intronic
1030550207 7:110948989-110949011 TGGTGGGGGCAGGGGAGCAGTGG - Intronic
1030651032 7:112116170-112116192 TGCTGGGGGCTGGGGAGAGGAGG - Intronic
1032524955 7:132573077-132573099 TGGTGGGGGCAGAGAAGTGGGGG + Intronic
1032526726 7:132583446-132583468 TGCTGAGGGCACAGGAGAGAAGG - Intronic
1032541243 7:132704896-132704918 GGCTGGAGGCCCGGGAGTTGTGG - Intronic
1032602855 7:133317943-133317965 TGCTGGTCGCCCGGGTGTGGTGG - Intronic
1032965623 7:137093801-137093823 TGCTGGTGGCAGTGGGGTGGTGG - Intergenic
1033836431 7:145317903-145317925 TGCTGGGGATACAGCAGTGGAGG + Intergenic
1034159608 7:148983254-148983276 GGGTGGGGGCGCGGGCGTGGGGG + Intergenic
1034451215 7:151138278-151138300 GCCTGGGGGCAGGGAAGTGGTGG - Exonic
1035116661 7:156530343-156530365 TGGTGGGGGAGCTGGAGTGGAGG - Intergenic
1035536278 8:393648-393670 TGCTGGAGTCACTGGAGTGCAGG - Intergenic
1036307350 8:7611721-7611743 TGCCGGGGGCTCGGGGGTGCCGG + Intergenic
1036358194 8:8059705-8059727 TGCCGGGGGCTCGGGGGTGCCGG + Intergenic
1036528351 8:9556238-9556260 CGCTGGGACCACGGGAGCGGCGG - Exonic
1036892756 8:12607238-12607260 TGCCGGGGGCTCGGGGGTGCCGG - Intergenic
1037936290 8:22917113-22917135 TGCTGGGGGCGGGGGAGGGGGGG + Intronic
1038439218 8:27560004-27560026 TGGTGGGAGCACAGGGGTGGAGG + Intergenic
1039419024 8:37420273-37420295 TGCTGGAGGGGAGGGAGTGGTGG - Intergenic
1039921315 8:41896281-41896303 TGCTGGGGGCAGGGGTCGGGCGG - Intronic
1040553041 8:48453425-48453447 TGCTGTGGGCAGGGGTGGGGGGG + Intergenic
1041744898 8:61197938-61197960 TGCTGGGGATAGGGGAGGGGTGG + Intronic
1042586842 8:70348992-70349014 TGTGGGGGGCATGGCAGTGGGGG + Intronic
1043785920 8:84399855-84399877 TGCTTGGGGGCCGGGTGTGGTGG + Intronic
1043891234 8:85654487-85654509 TTCCGGGGGACCGGGAGTGGGGG + Intergenic
1043892308 8:85661324-85661346 TTCCGGGGGACCGGGAGTGGGGG + Intergenic
1043893253 8:85716016-85716038 TTCCGGGGGACCGGGAGTGGGGG - Intergenic
1043895936 8:85737465-85737487 TTCCGGGGGACCGGGAGTGGGGG - Intergenic
1043896743 8:85744343-85744365 TTCCGGGGGACCGGGAGTGGGGG + Intergenic
1043899066 8:85762710-85762732 TTCCGGGGGACCGGGAGTGGGGG + Intergenic
1043900677 8:85774904-85774926 TTCCGGGGGACCGGGAGTGGGGG + Intergenic
1043902641 8:85790179-85790201 TTCCGGGGGACCGGGAGTGGGGG + Intergenic
1043904251 8:85802372-85802394 TTCCGGGGGACCGGGAGTGGGGG + Intergenic
1043905863 8:85814566-85814588 TTCCGGGGGACCGGGAGTGGGGG + Intergenic
1043907471 8:85826753-85826775 TTCCGGGGGACCGGGAGTGGGGG + Intergenic
1044628959 8:94261021-94261043 TGCAGTGGGCAGGGGAGGGGAGG - Intronic
1047219877 8:122910732-122910754 TGCTGGGGGGTGGGGGGTGGGGG + Intronic
1047533792 8:125700826-125700848 TGCTGGGGGCAGTGGAGGGCAGG - Intergenic
1048403278 8:134092514-134092536 TGCTTGAGGCAGGGGGGTGGAGG + Intergenic
1048968371 8:139630055-139630077 TGCGGGGGGAGCGGGCGTGGGGG + Intronic
1049292655 8:141812829-141812851 TGCTGGGGGTCAGGGAGTGAGGG - Intergenic
1049292737 8:141813058-141813080 TGCTGGGGGTCAGGGAGTGAGGG - Intergenic
1049372870 8:142276055-142276077 CGCTGGGGGCAAGGGTGGGGTGG - Intronic
1049406330 8:142453223-142453245 GGCTGGGGGCACGTGTGTGCAGG + Intronic
1049415009 8:142491107-142491129 TGCTGTGGGCATGGGGCTGGGGG - Intronic
1049611908 8:143559717-143559739 TGGTGGGGGCGGGGGAGAGGCGG + Intronic
1049644508 8:143730072-143730094 GGCTAGAGGCACGGGGGTGGAGG - Intronic
1049682908 8:143927686-143927708 TGCGGGGGGCACAGGAGGTGGGG - Exonic
1049734952 8:144199861-144199883 GGCTGGGGGCAGGGTTGTGGTGG + Intronic
1049761110 8:144332384-144332406 TGCCTGGGGTACGGGGGTGGGGG + Exonic
1049789208 8:144465431-144465453 AACTGGGGGCACGGCAGAGGAGG - Intronic
1050330997 9:4546053-4546075 TGGTGGGGGCACGGGAGGGTGGG + Intronic
1050829520 9:9992795-9992817 TGCTGGGGGATGGGGAGAGGGGG + Intronic
1051345588 9:16148033-16148055 TGCTGGGGGCTGGGGAGGGGTGG - Intergenic
1051896032 9:21989999-21990021 TGGTGGGGGCTGAGGAGTGGAGG + Intronic
1052974006 9:34398781-34398803 TGATGGGGGCACAGGGGTTGGGG + Exonic
1053003401 9:34589990-34590012 TGCTGGGCGAGTGGGAGTGGGGG - Intronic
1053157774 9:35792243-35792265 TGCTGGGGGCCGGGGAGAGGAGG - Exonic
1053292518 9:36890720-36890742 TGCTGTGGGCAAGAGTGTGGAGG - Intronic
1056163547 9:83921265-83921287 GGCTGGGGGCGCGGGAGCGGCGG + Intronic
1057205725 9:93171276-93171298 TGCTGGGGGCTGGGCAGGGGTGG - Intergenic
1057825533 9:98369796-98369818 TGCAGGGGGCTAGGGTGTGGTGG + Intronic
1058800485 9:108540409-108540431 TGCTGGGGGTAGGGTGGTGGTGG + Intergenic
1060991224 9:127850320-127850342 TGCTGGGGACAGAGGAGAGGTGG + Intronic
1061326778 9:129869004-129869026 TTCGGGGGGCACGGGAGGGTGGG + Intronic
1061389057 9:130307187-130307209 TGCTGGGGGCGAGGGAGAAGCGG + Intronic
1061434659 9:130553711-130553733 TCCTGGTGGGACAGGAGTGGGGG - Intergenic
1061487778 9:130929002-130929024 GGCTGGGGGCAGGGGTGGGGAGG + Intronic
1061601236 9:131671524-131671546 TTCTGGGGGCACTGGAATGCAGG + Intronic
1061666614 9:132163657-132163679 CCCTGGGGGCACGGGAGGGAGGG - Intronic
1061684573 9:132264579-132264601 TGCTGGGGGCTCGAGGGTTGTGG + Exonic
1061870746 9:133519084-133519106 TCCTGGGGGCTGGGGGGTGGGGG - Intronic
1062021187 9:134320102-134320124 TGCTGGGGGCTCGGAGCTGGGGG + Intronic
1062192156 9:135253571-135253593 GTCTGGGGGCACGGGTGGGGTGG + Intergenic
1062308308 9:135921864-135921886 AGCTGGGGGCACGGGAGCAAAGG - Intergenic
1062521344 9:136959247-136959269 TGCTTGGGGCATGGGGGTAGGGG - Intergenic
1062665226 9:137667124-137667146 TGCTGGGGACACGTGAGCGATGG - Intronic
1185737124 X:2502387-2502409 TGTTGGGGGCAGGGAAGTGGAGG - Intronic
1186067141 X:5778280-5778302 TGCTAGTGACATGGGAGTGGAGG - Intergenic
1186356825 X:8799648-8799670 GGATGGGGGCAGGGGAGGGGAGG - Intronic
1186357152 X:8800763-8800785 GGATGGGGGCAGGGGAGGGGAGG - Intronic
1186531051 X:10296064-10296086 TGCTGGGGACACAGCAGTGATGG - Intergenic
1186611398 X:11140928-11140950 TGTTGGGGACAGGGGAGTGGGGG + Intronic
1187388732 X:18872079-18872101 AGCTGGGGGCAGGGGGGCGGGGG - Intergenic
1187505861 X:19877902-19877924 TTCTGTGGCCACGGAAGTGGTGG - Intronic
1187610720 X:20939863-20939885 TGCTGGGGGTAAGGGAGGGGTGG + Intergenic
1187794313 X:22985544-22985566 TGCTGGGGGATCGGGACAGGAGG - Intergenic
1188925399 X:36036211-36036233 TTCTAGGGGCTTGGGAGTGGGGG - Intronic
1190000230 X:46679021-46679043 TGGTGGGGGCATTGGGGTGGGGG - Intronic
1190085911 X:47395087-47395109 TGCTGGGGTTACAGGTGTGGAGG + Intronic
1190303122 X:49067734-49067756 TGCGGGTGGCACGGGTGTGGGGG - Exonic
1190604694 X:52128627-52128649 TGCAGGAGGCAGGGGTGTGGGGG - Intergenic
1191638895 X:63409284-63409306 AGCAGGGGGTACGTGAGTGGGGG - Intergenic
1192363715 X:70454742-70454764 TGATGAGGGGAGGGGAGTGGGGG - Intronic
1192565466 X:72159740-72159762 TGCTGGGGGGATGGGGGTAGTGG - Intergenic
1192784653 X:74324459-74324481 GGCTGGGGGAATGGGAATGGGGG + Intergenic
1192803974 X:74493876-74493898 GGCTGGGGGGATGGGAATGGGGG - Intronic
1193880272 X:86912189-86912211 TGCTGGGGGCAAAGGAGGTGTGG + Intergenic
1194427847 X:93762162-93762184 GGCAGGGGGCAGGGGGGTGGTGG - Intergenic
1195012600 X:100747897-100747919 TGTTGGGGGCTAGGGAGAGGAGG - Intergenic
1195208551 X:102627572-102627594 CGGTGGGGGCAGGGGTGTGGAGG - Intergenic
1195370611 X:104168610-104168632 TGATGAGGGCAAGGGAGTGAGGG + Intronic
1196810489 X:119625260-119625282 TGTTGGGGGTGCGGGATTGGGGG + Intronic
1197774026 X:130108811-130108833 TGTTGGGGGCAGGGGTGGGGGGG - Intronic
1198480380 X:137034836-137034858 TTCTGGGGGCAGGGAAGAGGGGG - Intergenic
1199358184 X:146885852-146885874 TGCTGGGGGTCGGGGAGGGGTGG - Intergenic
1199664103 X:150082902-150082924 TGCTGAGGGCAAGGAAGTGAGGG + Intergenic
1199699067 X:150363326-150363348 TGCTGGCGGCGCTGCAGTGGCGG - Intronic
1199726725 X:150590429-150590451 TGCTGGAGGATTGGGAGTGGTGG + Intronic
1199858460 X:151779134-151779156 TGGTGGGGGCTGGGGGGTGGAGG + Intergenic
1200045016 X:153396680-153396702 TGCTGGGTGCAAGGGAGCGGGGG + Intergenic
1200048372 X:153414791-153414813 TGGTGGGTGCCCGGGGGTGGGGG - Intergenic
1200064178 X:153496954-153496976 TGCTGGGGGGTGGGGGGTGGGGG - Intronic
1200071074 X:153529710-153529732 GGCTGGGGGCTGGGGAGTTGGGG - Intronic
1200135171 X:153871243-153871265 AGGTGGGGGCAGGGGGGTGGCGG + Intronic
1200256403 X:154585296-154585318 TGCTGGCGGCCCAGGAGAGGCGG + Exonic
1200261366 X:154619107-154619129 TGCTGGCGGCCCAGGAGAGGCGG - Exonic
1200267349 X:154653404-154653426 TGCTGGCGGCCCAGGAGAGGCGG - Exonic
1200342906 X:155417964-155417986 TGCTGGGGACTGGAGAGTGGGGG + Intergenic
1200487541 Y:3787031-3787053 TGGTGGGGGCGGGGGGGTGGGGG + Intergenic
1200690804 Y:6305464-6305486 TGCTGGGGCGAGGGCAGTGGGGG + Intergenic
1201044468 Y:9869252-9869274 TGCTGGGGCGAGGGCAGTGGGGG - Intergenic