ID: 929604506

View in Genome Browser
Species Human (GRCh38)
Location 2:43225990-43226012
Sequence CACCTCGGCAGCCGGGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 240}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929604506_929604522 23 Left 929604506 2:43225990-43226012 CCTCCGCCCCGGCTGCCGAGGTG 0: 1
1: 0
2: 0
3: 20
4: 240
Right 929604522 2:43226036-43226058 AGCCCCGGGCAGCGTGGCCGCGG 0: 1
1: 1
2: 0
3: 18
4: 226
929604506_929604516 -1 Left 929604506 2:43225990-43226012 CCTCCGCCCCGGCTGCCGAGGTG 0: 1
1: 0
2: 0
3: 20
4: 240
Right 929604516 2:43226012-43226034 GGGCGGCGCGAAGCCTGTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 74
929604506_929604517 8 Left 929604506 2:43225990-43226012 CCTCCGCCCCGGCTGCCGAGGTG 0: 1
1: 0
2: 0
3: 20
4: 240
Right 929604517 2:43226021-43226043 GAAGCCTGTCCGGGAAGCCCCGG 0: 1
1: 1
2: 0
3: 17
4: 176
929604506_929604526 27 Left 929604506 2:43225990-43226012 CCTCCGCCCCGGCTGCCGAGGTG 0: 1
1: 0
2: 0
3: 20
4: 240
Right 929604526 2:43226040-43226062 CCGGGCAGCGTGGCCGCGGTCGG 0: 1
1: 0
2: 0
3: 4
4: 128
929604506_929604515 -2 Left 929604506 2:43225990-43226012 CCTCCGCCCCGGCTGCCGAGGTG 0: 1
1: 0
2: 0
3: 20
4: 240
Right 929604515 2:43226011-43226033 TGGGCGGCGCGAAGCCTGTCCGG 0: 1
1: 0
2: 0
3: 1
4: 57
929604506_929604521 17 Left 929604506 2:43225990-43226012 CCTCCGCCCCGGCTGCCGAGGTG 0: 1
1: 0
2: 0
3: 20
4: 240
Right 929604521 2:43226030-43226052 CCGGGAAGCCCCGGGCAGCGTGG 0: 1
1: 0
2: 6
3: 53
4: 295
929604506_929604518 9 Left 929604506 2:43225990-43226012 CCTCCGCCCCGGCTGCCGAGGTG 0: 1
1: 0
2: 0
3: 20
4: 240
Right 929604518 2:43226022-43226044 AAGCCTGTCCGGGAAGCCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929604506 Original CRISPR CACCTCGGCAGCCGGGGCGG AGG (reversed) Intronic