ID: 929604562

View in Genome Browser
Species Human (GRCh38)
Location 2:43226179-43226201
Sequence GAGGGGCGTCCCCCAGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929604555_929604562 -1 Left 929604555 2:43226157-43226179 CCCGACCTGAAAGGCAGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 929604562 2:43226179-43226201 GAGGGGCGTCCCCCAGAACCTGG 0: 1
1: 0
2: 0
3: 14
4: 139
929604557_929604562 -2 Left 929604557 2:43226158-43226180 CCGACCTGAAAGGCAGGGCGGGA 0: 1
1: 0
2: 1
3: 16
4: 200
Right 929604562 2:43226179-43226201 GAGGGGCGTCCCCCAGAACCTGG 0: 1
1: 0
2: 0
3: 14
4: 139
929604560_929604562 -6 Left 929604560 2:43226162-43226184 CCTGAAAGGCAGGGCGGGAGGGG 0: 1
1: 0
2: 5
3: 53
4: 391
Right 929604562 2:43226179-43226201 GAGGGGCGTCCCCCAGAACCTGG 0: 1
1: 0
2: 0
3: 14
4: 139
929604548_929604562 11 Left 929604548 2:43226145-43226167 CCCCGGGACTTTCCCGACCTGAA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 929604562 2:43226179-43226201 GAGGGGCGTCCCCCAGAACCTGG 0: 1
1: 0
2: 0
3: 14
4: 139
929604549_929604562 10 Left 929604549 2:43226146-43226168 CCCGGGACTTTCCCGACCTGAAA 0: 1
1: 0
2: 1
3: 7
4: 75
Right 929604562 2:43226179-43226201 GAGGGGCGTCCCCCAGAACCTGG 0: 1
1: 0
2: 0
3: 14
4: 139
929604550_929604562 9 Left 929604550 2:43226147-43226169 CCGGGACTTTCCCGACCTGAAAG 0: 1
1: 0
2: 0
3: 2
4: 73
Right 929604562 2:43226179-43226201 GAGGGGCGTCCCCCAGAACCTGG 0: 1
1: 0
2: 0
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929604562 Original CRISPR GAGGGGCGTCCCCCAGAACC TGG Intronic