ID: 929604720

View in Genome Browser
Species Human (GRCh38)
Location 2:43226722-43226744
Sequence GCCTGACGTCCGCGAGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929604720_929604733 23 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604733 2:43226768-43226790 GCCGCCAATTTTTTTCCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 88
929604720_929604724 -2 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG 0: 1
1: 0
2: 1
3: 7
4: 123
929604720_929604738 28 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604738 2:43226773-43226795 CAATTTTTTTCCTCCGGGGGAGG 0: 1
1: 1
2: 0
3: 8
4: 124
929604720_929604732 22 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604732 2:43226767-43226789 CGCCGCCAATTTTTTTCCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 52
929604720_929604735 24 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604735 2:43226769-43226791 CCGCCAATTTTTTTCCTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 90
929604720_929604739 29 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604739 2:43226774-43226796 AATTTTTTTCCTCCGGGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 170
929604720_929604736 25 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604736 2:43226770-43226792 CGCCAATTTTTTTCCTCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929604720 Original CRISPR GCCTGACGTCCGCGAGCGGG CGG (reversed) Intergenic