ID: 929604720

View in Genome Browser
Species Human (GRCh38)
Location 2:43226722-43226744
Sequence GCCTGACGTCCGCGAGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929604720_929604739 29 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604739 2:43226774-43226796 AATTTTTTTCCTCCGGGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 170
929604720_929604736 25 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604736 2:43226770-43226792 CGCCAATTTTTTTCCTCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 52
929604720_929604732 22 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604732 2:43226767-43226789 CGCCGCCAATTTTTTTCCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 52
929604720_929604738 28 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604738 2:43226773-43226795 CAATTTTTTTCCTCCGGGGGAGG 0: 1
1: 1
2: 0
3: 8
4: 124
929604720_929604733 23 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604733 2:43226768-43226790 GCCGCCAATTTTTTTCCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 88
929604720_929604735 24 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604735 2:43226769-43226791 CCGCCAATTTTTTTCCTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 90
929604720_929604724 -2 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG 0: 1
1: 0
2: 1
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929604720 Original CRISPR GCCTGACGTCCGCGAGCGGG CGG (reversed) Intergenic
912513943 1:110206597-110206619 GCCTGACATCCCTAAGCGGGGGG + Intergenic
1078411178 11:11120098-11120120 GCCTGAGGTCTGAGAGAGGGAGG - Intergenic
1078561700 11:12377996-12378018 CCCGGGCGACCGCGAGCGGGCGG - Intronic
1083741456 11:64713679-64713701 GCATGGCGTCCGGGAGCCGGTGG - Exonic
1084954821 11:72685567-72685589 GCCTGATGTGAGCCAGCGGGGGG - Exonic
1085310414 11:75513406-75513428 GCCTGAGGTCAGAGAGCCGGTGG + Intronic
1091582715 12:1798855-1798877 GACTCACATCCGCGATCGGGTGG - Intronic
1092094276 12:5828402-5828424 GGCTGGCGTCCCCGAGCAGGTGG - Intronic
1124628923 15:31326457-31326479 GCATGACGTCCGGGGGCGGCGGG - Intergenic
1132862208 16:2077246-2077268 GCCTGCCTTCCGCGGGTGGGTGG + Intronic
1133924794 16:10183445-10183467 ACCAGACGCCCGGGAGCGGGCGG - Intergenic
1139484049 16:67246394-67246416 GGCTGACGGCGGCGAGAGGGAGG + Intronic
1141694465 16:85613141-85613163 CCCTGACCTCAGCCAGCGGGAGG - Intronic
1145960899 17:28886042-28886064 GCCTGACGCCTGGGGGCGGGGGG + Intronic
1152739692 17:82013493-82013515 GCCTGCCGTCAGAGAGCTGGCGG + Intronic
1161302192 19:3548077-3548099 GCCTGAAGTCCTCGAGCCAGGGG - Intronic
1161919429 19:7255036-7255058 GCCTGGCTTCCTGGAGCGGGTGG - Intronic
1163508963 19:17724218-17724240 GGCTGACGTCCTGGAGGGGGCGG + Intronic
1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG + Exonic
924988065 2:288742-288764 GCCTGACGTCGGCGGGCGCGGGG - Intronic
925528885 2:4837778-4837800 GTCTGATGTCCAAGAGCGGGAGG + Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
1178498889 21:33109807-33109829 GCCAGATGTCCCGGAGCGGGAGG - Intergenic
1183601512 22:38843165-38843187 GCCGGACGACCGCGGCCGGGCGG + Intronic
972351012 4:38236251-38236273 GCCTGATGTCCAAGAGCAGGAGG + Intergenic
985064343 4:186105589-186105611 GCCTGACATCGGCGAGGAGGGGG + Intronic
998833421 5:146182568-146182590 GCCTGGCATCCCCGAGAGGGAGG - Exonic
1041030957 8:53734762-53734784 GACTGACGCCCGGTAGCGGGTGG - Intronic
1045063665 8:98427607-98427629 GCCTGTCTGCGGCGAGCGGGCGG + Intronic
1045098695 8:98825229-98825251 GCCTGACCTCCCGGGGCGGGAGG - Intronic
1056406838 9:86282775-86282797 GCGTGACGTCGGGGAGCGGGCGG + Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1060468671 9:123929957-123929979 GCCGGTCGGCCGCGGGCGGGCGG - Exonic
1061405320 9:130390548-130390570 GCCTGAAGGCCGGGAGTGGGAGG + Intronic
1190862717 X:54359002-54359024 GCCTGGCGGCGGCGAGGGGGCGG - Intergenic
1197711947 X:129678017-129678039 TCCTGGCCGCCGCGAGCGGGCGG + Intergenic