ID: 929604724

View in Genome Browser
Species Human (GRCh38)
Location 2:43226743-43226765
Sequence GCGCCTTCCCGGCCTCCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 123}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929604714_929604724 21 Left 929604714 2:43226699-43226721 CCGGGGTCTCCAGGCAACGCCGC 0: 1
1: 0
2: 2
3: 11
4: 167
Right 929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG 0: 1
1: 0
2: 1
3: 7
4: 123
929604721_929604724 -5 Left 929604721 2:43226725-43226747 CCCGCTCGCGGACGTCAGGCGCC 0: 1
1: 0
2: 1
3: 0
4: 38
Right 929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG 0: 1
1: 0
2: 1
3: 7
4: 123
929604712_929604724 25 Left 929604712 2:43226695-43226717 CCCGCCGGGGTCTCCAGGCAACG 0: 1
1: 0
2: 0
3: 15
4: 134
Right 929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG 0: 1
1: 0
2: 1
3: 7
4: 123
929604710_929604724 27 Left 929604710 2:43226693-43226715 CCCCCGCCGGGGTCTCCAGGCAA 0: 1
1: 0
2: 0
3: 14
4: 125
Right 929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG 0: 1
1: 0
2: 1
3: 7
4: 123
929604720_929604724 -2 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG 0: 1
1: 0
2: 1
3: 7
4: 123
929604711_929604724 26 Left 929604711 2:43226694-43226716 CCCCGCCGGGGTCTCCAGGCAAC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG 0: 1
1: 0
2: 1
3: 7
4: 123
929604717_929604724 2 Left 929604717 2:43226718-43226740 CCGCCCGCCCGCTCGCGGACGTC 0: 1
1: 0
2: 1
3: 15
4: 104
Right 929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG 0: 1
1: 0
2: 1
3: 7
4: 123
929604722_929604724 -6 Left 929604722 2:43226726-43226748 CCGCTCGCGGACGTCAGGCGCCT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG 0: 1
1: 0
2: 1
3: 7
4: 123
929604718_929604724 -1 Left 929604718 2:43226721-43226743 CCCGCCCGCTCGCGGACGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG 0: 1
1: 0
2: 1
3: 7
4: 123
929604713_929604724 24 Left 929604713 2:43226696-43226718 CCGCCGGGGTCTCCAGGCAACGC 0: 1
1: 0
2: 1
3: 11
4: 117
Right 929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG 0: 1
1: 0
2: 1
3: 7
4: 123
929604715_929604724 12 Left 929604715 2:43226708-43226730 CCAGGCAACGCCGCCCGCCCGCT 0: 1
1: 0
2: 2
3: 23
4: 131
Right 929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG 0: 1
1: 0
2: 1
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929604724 Original CRISPR GCGCCTTCCCGGCCTCCCAT TGG Intergenic
900145559 1:1157480-1157502 GCCCCAGCCCTGCCTCCCATCGG + Intergenic
900538948 1:3193283-3193305 GCTCCTGCCCGGCCCCCCAAGGG + Intronic
900545963 1:3229361-3229383 GCCCCTCCCCGGCCTCCCCTAGG + Intronic
901080204 1:6579895-6579917 GCGTCGTCCCCGCATCCCATTGG + Intergenic
901373209 1:8817791-8817813 CCGCCTCCTCCGCCTCCCATTGG - Intergenic
901631268 1:10649329-10649351 GCGCCTTCACGGCCTTGCCTAGG + Exonic
901871759 1:12142571-12142593 GTGCCATCCTGGCCTCCCAGAGG - Exonic
902706384 1:18208161-18208183 GCCCCTTCCCTTCCTCCCAGGGG - Intronic
904043870 1:27599117-27599139 GCTCCTTCCTGACCTACCATGGG + Intronic
904720051 1:32500795-32500817 GCGCCTTCCCGGCTTTCCCCGGG - Intronic
905177913 1:36149495-36149517 GCGCCTGCGCGGCCTCCCGCGGG + Intronic
905548677 1:38818859-38818881 GCGCCTTCCAGGGCTCCCCGGGG + Intergenic
907545743 1:55258495-55258517 GTGCCTCCCCTGCCTCACATAGG + Intergenic
914457046 1:147845905-147845927 GCTCCTTCCCACCCTCCCACAGG - Intergenic
918040790 1:180912864-180912886 GCGCCTTCCCGGCCCGCGCTGGG - Intergenic
921287313 1:213620912-213620934 GCCTCTTCCCAGCCTCCCATTGG + Intergenic
923148846 1:231216585-231216607 GAGCCGTCCCGGCCTGCCACAGG - Exonic
1066381543 10:34906167-34906189 CCGCCTTCCCTGCCTTCCCTCGG + Intergenic
1067087603 10:43251078-43251100 GCACCTTCCCGGCCTCCATCAGG - Intronic
1073105715 10:101031188-101031210 GCACCGCCCCGGGCTCCCATTGG + Intergenic
1076998668 11:311355-311377 GAGCCTTCCCGCCCTCCTCTGGG + Intronic
1077000075 11:318404-318426 GAGCCTTCCCGCCCTCCTCTGGG - Intergenic
1077013791 11:391232-391254 GAGCCTGCCCGGCTGCCCATGGG - Intergenic
1077496106 11:2887096-2887118 GCACCTTCCCTCCCTCCCAGAGG - Intergenic
1081908448 11:46684036-46684058 TCTCCTTCCCTGCCTCCCCTTGG - Intronic
1083463762 11:62832160-62832182 GAGCGATCCCGCCCTCCCATTGG + Intergenic
1083823313 11:65184393-65184415 GCTCCTCCCTGGCCTCCGATTGG + Intronic
1091743716 12:2977509-2977531 GCACCTTCCCGGCCATCCTTTGG - Intronic
1097929558 12:65169465-65169487 GCTCCTCCCGCGCCTCCCATTGG + Intergenic
1102010762 12:109617060-109617082 GCCCGCTCCCAGCCTCCCATTGG + Intergenic
1102111012 12:110365938-110365960 GCCCCTCCCTGGCCTCCCCTAGG + Intergenic
1104929260 12:132329492-132329514 GCGCCTTCCCCGCCGCCCCCCGG - Intergenic
1109683565 13:65784285-65784307 GCTCCATCCCGGCCTCCCTCCGG + Intergenic
1112226547 13:97545585-97545607 GCGCCTCCCGGGCCTCCCCAAGG + Intergenic
1113805950 13:113110104-113110126 CCGCCTTCCCCGCCTCCGCTTGG - Intronic
1114663696 14:24366771-24366793 GCGGCTTCCCTCCCTCCCCTCGG - Intronic
1121822528 14:96983027-96983049 GTTGCTTCCTGGCCTCCCATTGG + Intergenic
1122031976 14:98919001-98919023 CCTCCTTCCCTGCCTCCCGTAGG + Intergenic
1122741054 14:103871895-103871917 GCGCCTTCCTGCCCTCCCGGTGG + Intergenic
1133020278 16:2964074-2964096 GGGGCTTCCCGGCCTCCCATGGG + Exonic
1133149665 16:3818175-3818197 CCTCCTCCCCGGCCCCCCATTGG - Intronic
1134809082 16:17151735-17151757 ATGCCATCCCGGCCTCCAATAGG + Intronic
1134809189 16:17152700-17152722 ATGCCATCCCGGCCTCCAATAGG + Intronic
1136516750 16:30773107-30773129 GCACCTTCCCAGCCTCCCAAAGG - Intronic
1136622074 16:31436098-31436120 GCAACTTCCAGGCCTCCCAGAGG + Exonic
1137707931 16:50548331-50548353 GCGCCTCCCCGCGCGCCCATTGG - Exonic
1140131161 16:72163121-72163143 GCGGCTTCACAGCCTCCCAGAGG + Intronic
1148432102 17:47650498-47650520 GGGCCTTCCCGCCCTCCCGGAGG + Intronic
1155579788 18:27290280-27290302 ATGCCTTCCCAGCCTCCCCTGGG - Intergenic
1160795168 19:942076-942098 GCGCCTCCCCTGCCCGCCATGGG + Intronic
1161454593 19:4363658-4363680 GCACCACCCCGGCCTCCCAAGGG + Intronic
1161902933 19:7133015-7133037 CTCCCTTCACGGCCTCCCATAGG - Intronic
1162143325 19:8597536-8597558 CCTCCTGCCTGGCCTCCCATAGG + Intronic
1162965053 19:14151588-14151610 CAGGCTTCCCGGCCTCCCAAGGG + Exonic
1165094750 19:33403966-33403988 CCGCCTTCCCGGCCAGCCGTGGG - Intronic
929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG + Intergenic
932209357 2:69914736-69914758 GCACCTCGCCGGTCTCCCATTGG - Intronic
933666164 2:84966968-84966990 AAGCCTTCCCTGCCTCCCTTAGG - Intergenic
936141684 2:109947180-109947202 GCGCCCTCCCCTCTTCCCATGGG - Intergenic
936178372 2:110245128-110245150 GCGCCCTCCCCTCTTCCCATGGG - Intergenic
936203006 2:110424304-110424326 GCGCCCTCCCCTCTTCCCATGGG + Intronic
937242777 2:120473340-120473362 TGGCCTTCCCGGCACCCCATTGG - Intergenic
938319794 2:130355528-130355550 GCCCCTCCCCGGCCTCCCTTGGG + Intergenic
948645469 2:239401205-239401227 GCGCCTGGCCGGCCTTCCATTGG + Intronic
1170538177 20:17362509-17362531 GAGCCTTTTCAGCCTCCCATTGG - Intronic
1171057432 20:21921019-21921041 CCTGCTTCCTGGCCTCCCATTGG + Intergenic
1172451527 20:35028334-35028356 CCGCCTCCTCGGCCTCCCAAAGG + Intronic
1175267139 20:57709777-57709799 GCGCCCCCCCGGCCTCCCCTCGG + Exonic
1175283346 20:57820144-57820166 CAGCCTCCCAGGCCTCCCATGGG - Intergenic
1175966346 20:62661880-62661902 GGGCCCTCCCGGCCTCTCCTGGG + Intronic
1176309991 21:5144490-5144512 GCACCTCCTCTGCCTCCCATGGG - Intronic
1179847065 21:44117542-44117564 GCACCTCCTCTGCCTCCCATGGG + Intronic
1180064330 21:45405124-45405146 CCCCCTGCCCGGCCTCCCAGCGG + Intronic
1181175637 22:21033196-21033218 GGGCCCTCCCGGCCTGCCAGAGG - Intergenic
1181316663 22:21975023-21975045 GCACCTACCTGGCCTCCCCTTGG - Intronic
1182079374 22:27518378-27518400 GCACCTTGCAGGCCTCCCCTTGG - Intergenic
1183427158 22:37746166-37746188 TCGGCTTCCCCGCCACCCATTGG + Intronic
1183585058 22:38748630-38748652 GCCCCTTCCCTGCCTGCCAAAGG + Intronic
1184472276 22:44702617-44702639 GCGCCCTCCCGGCCACCCGGAGG + Intronic
1184523572 22:45009138-45009160 GCCCCCTTCCGGCCTCCCCTCGG - Intronic
1185046828 22:48532792-48532814 GCCCCTGCCCCGGCTCCCATCGG + Intronic
951329705 3:21352019-21352041 CCGCCTTTCCTGCATCCCATAGG - Intergenic
956204480 3:66741348-66741370 ACGCCTTCTCTTCCTCCCATAGG + Intergenic
958911474 3:99999030-99999052 AAGCCTTCCGTGCCTCCCATAGG + Intronic
961133686 3:124491284-124491306 TCCCCTTCCCCGCCTCTCATAGG + Intronic
961322230 3:126084015-126084037 GCGCCTCCCCGACCCCCCTTGGG + Intronic
966671172 3:182527818-182527840 GGGCCCTGCAGGCCTCCCATAGG - Intergenic
969346787 4:6575187-6575209 GCACCTTCCCGGCCTGCCGCAGG + Exonic
969673620 4:8602978-8603000 TCGCCTCCCTGGCCTCCCACAGG - Intronic
972397898 4:38672941-38672963 GCCCCCTCCCCGCCTCCCATTGG - Intronic
975201935 4:71601346-71601368 TGTCCATCCCGGCCTCCCATGGG + Intergenic
977403515 4:96564989-96565011 GCACCATCCTGGTCTCCCATTGG + Intergenic
980701852 4:136442231-136442253 GAGCCTTCCCAGGCTCCCAGGGG - Intergenic
985593345 5:776446-776468 GGGCCTACCCGGTCTCCCTTGGG - Intergenic
985694351 5:1331469-1331491 GAGCCTTCCCGGCTGCTCATGGG - Intronic
990984092 5:61626081-61626103 GCACCTTTCCGGTCTCCTATTGG - Intergenic
991963044 5:72064865-72064887 GCTCCTGCCTGGCCTCCCAGAGG + Intergenic
992546340 5:77817570-77817592 AGGCCTTCCCGGCTTCTCATAGG + Intronic
998470067 5:142376710-142376732 CCGCCGTCTCGGCCTCCCAAAGG - Intergenic
1001691944 5:173639521-173639543 GCGGCTTCCGGATCTCCCATAGG - Intergenic
1001814708 5:174658579-174658601 GCGCCTTCCCTGCCACCTGTTGG - Intergenic
1002200630 5:177525821-177525843 GAGCCTTCCAGGCCTCACCTGGG - Intronic
1002405083 5:179024072-179024094 GCGCCCTCCCGGCCTCCGCCAGG - Intronic
1003603685 6:7541530-7541552 GCGCCTTCCCCGCCCCCCCGCGG - Intergenic
1004201763 6:13555140-13555162 GTGGCTTCCCTCCCTCCCATGGG - Intergenic
1006665665 6:35691229-35691251 ACGCCTTCCCTGCCTCTCGTAGG - Intronic
1017707547 6:157137733-157137755 GGCCCTTCCCAGACTCCCATAGG - Intronic
1019494697 7:1332317-1332339 GCACCTTCCCGGCTTCCCTAGGG - Intergenic
1019662522 7:2232708-2232730 GCGCCCGCCCCGTCTCCCATGGG - Intronic
1022410480 7:30135492-30135514 GCGCCTTGCCCGCCGCCCACCGG - Intronic
1027269587 7:76512401-76512423 CTGCCTTCCCGGCTTCCCCTGGG - Intronic
1027320297 7:77006295-77006317 CTGCCTTCCCGGCTTCCCCTGGG - Intergenic
1029604414 7:101590111-101590133 TCCCCTTGCCGGCCTCCCCTGGG + Intergenic
1029782414 7:102748750-102748772 GCCCCTTCCGTGCTTCCCATTGG + Intergenic
1034621971 7:152463733-152463755 GCCCCGGCCCGCCCTCCCATTGG - Intergenic
1034621988 7:152463783-152463805 GCCCCGGCCCGCCCTCCCATTGG - Intergenic
1035392055 7:158510931-158510953 GTACCTTCCCAGCCTCCCACAGG + Intronic
1041233230 8:55773554-55773576 GCGCCTGCCGGGCCTCCGCTCGG - Exonic
1045781119 8:105864683-105864705 TCGCCTGCTCGGCCTCCCAGAGG - Intergenic
1047346166 8:124030914-124030936 GTGCCTTCCCCACCTCCCACGGG - Intronic
1048465917 8:134664549-134664571 GTGCCTCCCAGGCCTCCCACGGG + Intronic
1049216803 8:141412067-141412089 GGGCCTTCTCCGCCTTCCATGGG + Intronic
1049624812 8:143615207-143615229 GCTCCTTCCCAGCCTCCAGTGGG - Intronic
1049815720 8:144598393-144598415 GCTCCTTCCCAGCCTCCCTGGGG - Intronic
1055248556 9:74276030-74276052 GAGCCTCCCCGGCCAGCCATGGG - Intergenic
1057694650 9:97314564-97314586 GCTTCTTCCCTGCCTCCCACCGG + Intronic
1061265140 9:129500524-129500546 GCGCCTCACCGGCCTCCCCGAGG + Intergenic
1061721946 9:132557325-132557347 ACGGCTTCCCGGCCTCCCGGTGG + Intronic
1062053554 9:134459244-134459266 CCGCCATCCTGGTCTCCCATAGG - Intergenic
1062536713 9:137024286-137024308 GGCCCTCCCCAGCCTCCCATAGG + Intronic
1189476851 X:41362740-41362762 GCTCCTGCCCCACCTCCCATAGG - Intronic
1200258884 X:154601089-154601111 GTGCCTTCCTGGCCTCTCCTGGG + Intergenic