ID: 929604732

View in Genome Browser
Species Human (GRCh38)
Location 2:43226767-43226789
Sequence CGCCGCCAATTTTTTTCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 52}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929604725_929604732 -2 Left 929604725 2:43226746-43226768 CCTTCCCGGCCTCCCATTGGCCG 0: 1
1: 0
2: 1
3: 28
4: 203
Right 929604732 2:43226767-43226789 CGCCGCCAATTTTTTTCCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 52
929604720_929604732 22 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604732 2:43226767-43226789 CGCCGCCAATTTTTTTCCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 52
929604726_929604732 -6 Left 929604726 2:43226750-43226772 CCCGGCCTCCCATTGGCCGCCGC 0: 1
1: 0
2: 0
3: 15
4: 171
Right 929604732 2:43226767-43226789 CGCCGCCAATTTTTTTCCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 52
929604717_929604732 26 Left 929604717 2:43226718-43226740 CCGCCCGCCCGCTCGCGGACGTC 0: 1
1: 0
2: 1
3: 15
4: 104
Right 929604732 2:43226767-43226789 CGCCGCCAATTTTTTTCCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 52
929604718_929604732 23 Left 929604718 2:43226721-43226743 CCCGCCCGCTCGCGGACGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 929604732 2:43226767-43226789 CGCCGCCAATTTTTTTCCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 52
929604721_929604732 19 Left 929604721 2:43226725-43226747 CCCGCTCGCGGACGTCAGGCGCC 0: 1
1: 0
2: 1
3: 0
4: 38
Right 929604732 2:43226767-43226789 CGCCGCCAATTTTTTTCCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 52
929604722_929604732 18 Left 929604722 2:43226726-43226748 CCGCTCGCGGACGTCAGGCGCCT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 929604732 2:43226767-43226789 CGCCGCCAATTTTTTTCCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 52
929604727_929604732 -7 Left 929604727 2:43226751-43226773 CCGGCCTCCCATTGGCCGCCGCC 0: 1
1: 0
2: 2
3: 25
4: 238
Right 929604732 2:43226767-43226789 CGCCGCCAATTTTTTTCCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929604732 Original CRISPR CGCCGCCAATTTTTTTCCTC CGG Intergenic
904034200 1:27550350-27550372 CGCCGTCGTTTTTTTACCTCTGG + Exonic
906592534 1:47039949-47039971 TGTCACCAATTTTATTCCTCAGG + Intronic
907798015 1:57737011-57737033 CGCCTCCCATTTCCTTCCTCAGG - Intronic
915926396 1:160023485-160023507 CCCAACCTATTTTTTTCCTCTGG - Intergenic
922112919 1:222579773-222579795 TGACGCCAATATTTTTCATCCGG + Exonic
1070342763 10:75512660-75512682 CTCCGCCCATTTCATTCCTCTGG - Intronic
1073952357 10:108824847-108824869 CCCCTCCCATTTTTTTCCTTTGG - Intergenic
1076200612 10:128554812-128554834 TGCCCCAAATTCTTTTCCTCAGG - Intergenic
1078005285 11:7527810-7527832 TGCCGCCAGTTGTTTTCCACAGG - Intronic
1094382923 12:29863319-29863341 CGTCCCCCACTTTTTTCCTCTGG - Intergenic
1097911872 12:64979216-64979238 CGCCTCCAATTTTGTTCTTTTGG + Intergenic
1100267060 12:92987671-92987693 TGATGCCAATTCTTTTCCTCAGG - Intergenic
1104329725 12:127833615-127833637 CGCCCCCAGTATTTCTCCTCCGG + Intergenic
1104464167 12:128977170-128977192 GGCCACCACTTCTTTTCCTCTGG + Intronic
1112766221 13:102747342-102747364 TGCCTCCCATTTTTTTCCTGTGG + Exonic
1125301216 15:38254559-38254581 AGCCGCGAATTTTTTTTCTTGGG - Intronic
1128481417 15:68043043-68043065 CCCAGCCAATTTTTTTTCTAAGG - Intergenic
1149712485 17:58756013-58756035 CGCCGGTAAGTTTTCTCCTCAGG - Exonic
1157829966 18:50848536-50848558 CGCCCCCAGTTTTTTTCCACAGG + Intergenic
1161855503 19:6762478-6762500 CCCGGCCCATTTTTTTCTTCCGG + Intronic
925490896 2:4391598-4391620 TGCCGCCAAGTTCTTTTCTCGGG + Intergenic
929604732 2:43226767-43226789 CGCCGCCAATTTTTTTCCTCCGG + Intergenic
930641808 2:53860394-53860416 CGCCGCCAATTTAATTCATGAGG - Intergenic
937100460 2:119264351-119264373 AGTCCCCAATATTTTTCCTCAGG - Exonic
942739934 2:179164690-179164712 CTCCTCCAATGTTTTTCATCAGG - Intronic
1174012701 20:47463399-47463421 CCCAGCTAATTTTTTTCCTCAGG - Intergenic
952131628 3:30370591-30370613 CACAGCCCATGTTTTTCCTCTGG - Intergenic
967488461 3:190061216-190061238 CTCCTTCACTTTTTTTCCTCTGG + Intronic
975777325 4:77801675-77801697 CCCCCCCAATTTTTATCTTCTGG - Intronic
976967782 4:91066407-91066429 CGCAGCCAAGATTTTTCCTATGG + Intronic
978611285 4:110543730-110543752 CACAGCCAATTTTATTTCTCTGG + Intronic
985079589 4:186251104-186251126 CGCAGCAAATTTTATTCTTCTGG - Intronic
986494037 5:8323631-8323653 CCTGGCCAGTTTTTTTCCTCTGG - Intergenic
991731856 5:69597348-69597370 CCCAGCCTATTTTTTTCTTCTGG + Intergenic
991808288 5:70452486-70452508 CCCAGCCTATTTTTTTCTTCTGG + Intergenic
991863096 5:71030519-71030541 CCCAGCCTATTTTTTTCTTCTGG - Intergenic
993651742 5:90529840-90529862 GGCCACCAAATCTTTTCCTCGGG - Intronic
995583957 5:113627947-113627969 AGCCTCCCATTTGTTTCCTCTGG + Intergenic
996037891 5:118779084-118779106 CTCCTGTAATTTTTTTCCTCTGG + Intergenic
998388946 5:141774555-141774577 CACAGCCCACTTTTTTCCTCGGG + Intergenic
998583551 5:143403945-143403967 CGCCGCCACCCTTTTTCCTGGGG - Intronic
999383198 5:151136226-151136248 CACAGCCTATTTTTTTCCTCTGG - Intronic
999542702 5:152591059-152591081 CGCCTCCAGTTTTGTTCTTCTGG - Intergenic
1013524483 6:110961634-110961656 TGGCAGCAATTTTTTTCCTCAGG + Intronic
1016635860 6:146289233-146289255 CACCTCCAATTTTGTCCCTCTGG - Intronic
1017260755 6:152383901-152383923 CGCATGCAATTATTTTCCTCAGG + Intronic
1018431473 6:163726070-163726092 GGCCGCCAGTCATTTTCCTCCGG - Intergenic
1042017457 8:64330619-64330641 CATCTCCAAATTTTTTCCTCAGG - Intergenic
1043036067 8:75201839-75201861 TGCCACTACTTTTTTTCCTCTGG + Intergenic
1046776465 8:118168827-118168849 TACCCCTAATTTTTTTCCTCTGG - Intergenic
1054948973 9:70827666-70827688 CGCCTCCAATTGTTCTCCTCTGG + Intronic
1059887498 9:118762524-118762546 TGAAGCAAATTTTTTTCCTCTGG - Intergenic
1062364299 9:136201710-136201732 CGCAGCCCAGTTTTTTCCGCCGG - Intronic
1186550776 X:10502961-10502983 CTCCTCCAATGTTTTTCCTTTGG - Intronic
1187079169 X:15968004-15968026 CACCGTCAATTGTTTTACTCTGG - Intergenic
1190812316 X:53896614-53896636 GTCAGCCAATTTTGTTCCTCCGG - Intergenic
1194916005 X:99709445-99709467 CTCCCCCAATTTTTTCCCTCTGG - Intergenic
1198971669 X:142288272-142288294 ATTCGTCAATTTTTTTCCTCTGG - Intergenic