ID: 929604733

View in Genome Browser
Species Human (GRCh38)
Location 2:43226768-43226790
Sequence GCCGCCAATTTTTTTCCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929604728_929604733 -10 Left 929604728 2:43226755-43226777 CCTCCCATTGGCCGCCGCCAATT 0: 1
1: 0
2: 0
3: 3
4: 38
Right 929604733 2:43226768-43226790 GCCGCCAATTTTTTTCCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 88
929604722_929604733 19 Left 929604722 2:43226726-43226748 CCGCTCGCGGACGTCAGGCGCCT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 929604733 2:43226768-43226790 GCCGCCAATTTTTTTCCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 88
929604721_929604733 20 Left 929604721 2:43226725-43226747 CCCGCTCGCGGACGTCAGGCGCC 0: 1
1: 0
2: 1
3: 0
4: 38
Right 929604733 2:43226768-43226790 GCCGCCAATTTTTTTCCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 88
929604725_929604733 -1 Left 929604725 2:43226746-43226768 CCTTCCCGGCCTCCCATTGGCCG 0: 1
1: 0
2: 1
3: 28
4: 203
Right 929604733 2:43226768-43226790 GCCGCCAATTTTTTTCCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 88
929604726_929604733 -5 Left 929604726 2:43226750-43226772 CCCGGCCTCCCATTGGCCGCCGC 0: 1
1: 0
2: 0
3: 15
4: 171
Right 929604733 2:43226768-43226790 GCCGCCAATTTTTTTCCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 88
929604727_929604733 -6 Left 929604727 2:43226751-43226773 CCGGCCTCCCATTGGCCGCCGCC 0: 1
1: 0
2: 2
3: 25
4: 238
Right 929604733 2:43226768-43226790 GCCGCCAATTTTTTTCCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 88
929604718_929604733 24 Left 929604718 2:43226721-43226743 CCCGCCCGCTCGCGGACGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 929604733 2:43226768-43226790 GCCGCCAATTTTTTTCCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 88
929604717_929604733 27 Left 929604717 2:43226718-43226740 CCGCCCGCCCGCTCGCGGACGTC 0: 1
1: 0
2: 1
3: 15
4: 104
Right 929604733 2:43226768-43226790 GCCGCCAATTTTTTTCCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 88
929604720_929604733 23 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604733 2:43226768-43226790 GCCGCCAATTTTTTTCCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929604733 Original CRISPR GCCGCCAATTTTTTTCCTCC GGG Intergenic
901179055 1:7327435-7327457 GTCTCCCATTTCTTTCCTCCTGG - Intronic
902655614 1:17865990-17866012 GGGGGCAATTTTTATCCTCCAGG - Intergenic
905324095 1:37138272-37138294 CCCAACAATTTTATTCCTCCAGG + Intergenic
905478035 1:38242636-38242658 ACAGCCAAGTTTTTTCCTTCAGG + Intergenic
917060737 1:171034750-171034772 GCCCCAATTTTTTTTCCTTCAGG - Intronic
917682895 1:177385719-177385741 GACTCCAATTTTTTTTTTCCTGG + Intergenic
1078407091 11:11079875-11079897 GCCTACAATTTTCTACCTCCAGG + Intergenic
1080160008 11:29162468-29162490 GTGGCCAATTTTTGCCCTCCAGG + Intergenic
1081133089 11:39404395-39404417 TGCTCCCATTTTTTTCCTCCAGG + Intergenic
1081782724 11:45724319-45724341 GCTGCCAGGTTTTTTTCTCCAGG + Intergenic
1081851085 11:46275730-46275752 GGGGCCACTTTTTCTCCTCCTGG + Intergenic
1083151709 11:60795687-60795709 GCCCCCATTTTTTGTCTTCCTGG - Intronic
1085846202 11:80068502-80068524 GCCACCATTTTCTTTCCACCTGG - Intergenic
1091838292 12:3601431-3601453 GCAGGAAATTCTTTTCCTCCTGG - Intergenic
1098352458 12:69578091-69578113 GCCGCCATATTTTTGCCTCAAGG + Exonic
1099817402 12:87667378-87667400 GCCCCGATTTTTTTTCCCCCAGG - Intergenic
1100267059 12:92987670-92987692 GATGCCAATTCTTTTCCTCAGGG - Intergenic
1102539940 12:113611123-113611145 GCAGCCAACCCTTTTCCTCCAGG - Intergenic
1115433416 14:33346929-33346951 CCTGCCAATATGTTTCCTCCAGG + Intronic
1117814968 14:59588038-59588060 GCCACCATTTGTTTTCCTCTTGG - Intergenic
1118737243 14:68710761-68710783 GCAACCAGTTTTTTTCCTCCCGG - Intronic
1126055261 15:44724105-44724127 GCCTTCAATTTTTTTCCTATAGG - Intergenic
1127221920 15:56888813-56888835 GACACCACTTTTTTTCCTCTTGG + Intronic
1137532000 16:49283591-49283613 CCCGCCCCTTTCTTTCCTCCTGG - Intergenic
1150164226 17:62926244-62926266 GCCTGCAGTTTTTTTCCTTCTGG + Intergenic
1150492226 17:65582414-65582436 GCCTCAAATGTTCTTCCTCCTGG + Intronic
1151464423 17:74275327-74275349 GCCCCCATTTATTTTCCCCCAGG - Intronic
1151801576 17:76382626-76382648 CCCCCCTTTTTTTTTCCTCCTGG - Intronic
1153116419 18:1662482-1662504 ACCTCCAATTGTATTCCTCCAGG + Intergenic
1159763868 18:72461640-72461662 GCCCTCAATTATTTTCCACCAGG + Intergenic
1163697711 19:18772363-18772385 GCCGCCAACTTTTTTTACCCTGG + Intronic
1166620131 19:44290151-44290173 TCCTCCAAGTTTCTTCCTCCAGG + Intronic
927028696 2:19097905-19097927 GCTGCCATTTTTTTTTTTCCTGG + Intergenic
927698632 2:25253388-25253410 GCCGCCCATTTTTTTCTACTTGG - Intronic
929604733 2:43226768-43226790 GCCGCCAATTTTTTTCCTCCGGG + Intergenic
933468545 2:82689078-82689100 AGGGCCATTTTTTTTCCTCCTGG + Intergenic
936674386 2:114698269-114698291 GCCTCCATTTTTTTTCCTTATGG - Intronic
937943372 2:127308526-127308548 GCCGCCTATGTATTTCCACCTGG - Intronic
942838239 2:180327471-180327493 GCCCACACTTTATTTCCTCCTGG - Intergenic
942996174 2:182263276-182263298 GCTGCCTATTTTTTTTCTCCTGG + Intronic
944905577 2:204258491-204258513 ACCTCCAATTATCTTCCTCCAGG - Intergenic
947407060 2:229789446-229789468 TCCCCCACTTTTTTTTCTCCTGG - Intronic
947842669 2:233218375-233218397 GCCTCCTATCTTTTTCCTCTTGG + Intronic
1169804768 20:9548105-9548127 GTCGCCAATTTTATTCCTCATGG + Intronic
1180572803 22:16744338-16744360 GCTGCCTATTTTTTTTCTCAAGG - Intergenic
1182056101 22:27355909-27355931 GCCACCAATTTGCTTCATCCAGG - Intergenic
949957943 3:9285477-9285499 GAGGACATTTTTTTTCCTCCAGG - Intronic
950770566 3:15307606-15307628 GCATACAATTTTTTTCCTCCTGG + Intronic
952584669 3:34876886-34876908 ACTGACATTTTTTTTCCTCCTGG - Intergenic
960528374 3:118736224-118736246 GCAGCAATTTTTTTTCTTCCTGG - Intergenic
961664842 3:128488685-128488707 GGTGGCATTTTTTTTCCTCCGGG + Intronic
961908333 3:130286282-130286304 TCCTCTAATTTTTTTTCTCCTGG - Intergenic
963428512 3:145163920-145163942 GCAGTCAATTTTGATCCTCCTGG + Intergenic
970931928 4:21522230-21522252 GCCTGCAATTTTTTTTTTCCTGG - Intronic
972520835 4:39854462-39854484 ACCTCCAATATTCTTCCTCCAGG + Intronic
973634430 4:52848856-52848878 GCAGCCAATTTTTTATCTCATGG + Intergenic
974019954 4:56684307-56684329 GCCACTAATTTTTTTCCTGCAGG + Intergenic
976671622 4:87660903-87660925 GACCCCAATTTTTTTTCTTCTGG - Intronic
983619891 4:169750010-169750032 GCGGACAAGTATTTTCCTCCTGG + Intronic
985319744 4:188697195-188697217 TTCTTCAATTTTTTTCCTCCAGG + Intergenic
989368905 5:40684482-40684504 GCAGCCAAGGTTTTGCCTCCTGG + Intronic
993651741 5:90529839-90529861 GCCACCAAATCTTTTCCTCGGGG - Intronic
994158622 5:96530651-96530673 TCCTCCAGTTTTTCTCCTCCTGG - Intronic
1007850811 6:44801123-44801145 GCCTCCTTTTTATTTCCTCCTGG - Intergenic
1008354483 6:50535151-50535173 ACCCCTAATTTTTTTCCTCGTGG - Intergenic
1011217348 6:85019061-85019083 GCTGGCACTTTTTTGCCTCCTGG + Intergenic
1011329434 6:86187389-86187411 GCTGCCAATTATTTTCCTTTAGG + Intergenic
1016571573 6:145519421-145519443 GCCGCTAATGTTTTCCCTTCAGG + Intronic
1023838374 7:44081578-44081600 GCCGCCATTTTTTCTTCTCTTGG + Intronic
1025870192 7:65423990-65424012 GTCCCCAATTCTGTTCCTCCTGG + Intergenic
1027484299 7:78741057-78741079 GCAGCCATTTTTTTTCCATCCGG + Intronic
1028812111 7:95099342-95099364 GCCACCAATTTATTTCATGCTGG + Intronic
1034566782 7:151921764-151921786 GCCGCCGCCTTTTGTCCTCCTGG - Intergenic
1038182962 8:25246180-25246202 GGCTTCAATTTTTGTCCTCCTGG + Intronic
1038430095 8:27493117-27493139 TCCTCAAATTTGTTTCCTCCAGG - Intronic
1041509967 8:58645205-58645227 GCCCCCAATTCTTTTCCTGATGG + Intronic
1042876286 8:73443177-73443199 GTCACCCTTTTTTTTCCTCCTGG - Intronic
1043036068 8:75201840-75201862 GCCACTACTTTTTTTCCTCTGGG + Intergenic
1046657280 8:116908772-116908794 GCAGCCAAGTTTTTTCCATCAGG - Intergenic
1046776464 8:118168826-118168848 ACCCCTAATTTTTTTCCTCTGGG - Intergenic
1047758223 8:127934850-127934872 GCCTCCACTTTTGTTGCTCCTGG + Intergenic
1049290920 8:141801441-141801463 GCAGCCTCTTTATTTCCTCCAGG + Intergenic
1050160854 9:2717703-2717725 GACGCCTAGCTTTTTCCTCCTGG - Exonic
1055013877 9:71595366-71595388 TAAGGCAATTTTTTTCCTCCTGG - Intergenic
1055706556 9:79011404-79011426 GCCCCTATTTTCTTTCCTCCAGG - Intergenic
1060752914 9:126185875-126185897 GGAGCAATTTTTTTTCCTCCTGG - Intergenic
1061517208 9:131096780-131096802 GCCGCCTCTTTGTCTCCTCCAGG + Exonic
1062328225 9:136022990-136023012 GCCTTCATTTTTCTTCCTCCTGG - Intronic
1194135951 X:90141884-90141906 GCCACCAATTTTTTCCCTGAAGG + Intergenic
1195108307 X:101621597-101621619 GCCAACACTTTTTCTCCTCCAGG + Intergenic
1196599879 X:117589776-117589798 TCTGCCATTTTTTTTCCTGCTGG + Intergenic
1197640883 X:128966805-128966827 GCTTCCAATTTTATCCCTCCGGG + Intergenic
1200481707 Y:3711960-3711982 GCCACCAATTTTTTCCCTGAAGG + Intergenic
1200968531 Y:9125128-9125150 GACGTCAATTTTTTTTTTCCAGG - Intergenic