ID: 929604735

View in Genome Browser
Species Human (GRCh38)
Location 2:43226769-43226791
Sequence CCGCCAATTTTTTTCCTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929604725_929604735 0 Left 929604725 2:43226746-43226768 CCTTCCCGGCCTCCCATTGGCCG 0: 1
1: 0
2: 1
3: 28
4: 203
Right 929604735 2:43226769-43226791 CCGCCAATTTTTTTCCTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 90
929604720_929604735 24 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604735 2:43226769-43226791 CCGCCAATTTTTTTCCTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 90
929604726_929604735 -4 Left 929604726 2:43226750-43226772 CCCGGCCTCCCATTGGCCGCCGC 0: 1
1: 0
2: 0
3: 15
4: 171
Right 929604735 2:43226769-43226791 CCGCCAATTTTTTTCCTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 90
929604721_929604735 21 Left 929604721 2:43226725-43226747 CCCGCTCGCGGACGTCAGGCGCC 0: 1
1: 0
2: 1
3: 0
4: 38
Right 929604735 2:43226769-43226791 CCGCCAATTTTTTTCCTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 90
929604727_929604735 -5 Left 929604727 2:43226751-43226773 CCGGCCTCCCATTGGCCGCCGCC 0: 1
1: 0
2: 2
3: 25
4: 238
Right 929604735 2:43226769-43226791 CCGCCAATTTTTTTCCTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 90
929604728_929604735 -9 Left 929604728 2:43226755-43226777 CCTCCCATTGGCCGCCGCCAATT 0: 1
1: 0
2: 0
3: 3
4: 38
Right 929604735 2:43226769-43226791 CCGCCAATTTTTTTCCTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 90
929604718_929604735 25 Left 929604718 2:43226721-43226743 CCCGCCCGCTCGCGGACGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 929604735 2:43226769-43226791 CCGCCAATTTTTTTCCTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 90
929604722_929604735 20 Left 929604722 2:43226726-43226748 CCGCTCGCGGACGTCAGGCGCCT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 929604735 2:43226769-43226791 CCGCCAATTTTTTTCCTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 90
929604717_929604735 28 Left 929604717 2:43226718-43226740 CCGCCCGCCCGCTCGCGGACGTC 0: 1
1: 0
2: 1
3: 15
4: 104
Right 929604735 2:43226769-43226791 CCGCCAATTTTTTTCCTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929604735 Original CRISPR CCGCCAATTTTTTTCCTCCG GGG Intergenic
904557084 1:31372490-31372512 CCACTAATCTTTTTCCTCCTAGG + Intronic
905324097 1:37138273-37138295 CCAACAATTTTATTCCTCCAGGG + Intergenic
905973401 1:42157417-42157439 CCTCCAACTTTGCTCCTCCGCGG - Intergenic
916202947 1:162289053-162289075 TAGCCCATTTTTTTCCTCTGAGG - Intronic
916816908 1:168363002-168363024 CAGTCAATTTTTTTCTTCTGAGG + Intergenic
1063043464 10:2368129-2368151 GGGCCTGTTTTTTTCCTCCGTGG + Intergenic
1069071095 10:63991216-63991238 CAGCCAAATTCTTTCCTCCAAGG + Intergenic
1076268141 10:129126780-129126802 CTGCCAAATTTTTTCCTAAGCGG - Intergenic
1078116443 11:8456648-8456670 CCCCCCGTTTTTTTCCTTCGAGG - Intronic
1094780858 12:33790132-33790154 AAGCCATTTTTTTTCCTCCTAGG + Intergenic
1099384585 12:81998983-81999005 CAGTGAATTTTTTTCCTCAGAGG - Intergenic
1100267058 12:92987669-92987691 ATGCCAATTCTTTTCCTCAGGGG - Intergenic
1109333851 13:60966985-60967007 CAGTCGATTTTTTTCCTCTGAGG + Intergenic
1109822398 13:67675107-67675129 CTTCCAATTTTTTTCCACTGTGG + Intergenic
1114878275 14:26750892-26750914 CAGCCAAATTATTTCCTCTGAGG + Intergenic
1119064760 14:71514012-71514034 CAGTCAATTTTTTTCTTCTGAGG - Intronic
1120379808 14:83762538-83762560 TAGCCAATTTTTTTCCTCCTTGG - Intergenic
1129852606 15:78802538-78802560 CTGCCAATTTTTTCCATCCCTGG - Intronic
1130153704 15:81332124-81332146 CTGCCAAATTCTTTCTTCCGAGG + Exonic
1130250376 15:82296529-82296551 CTGCCAATTTTTTCCATCCCTGG + Intergenic
1130613297 15:85380721-85380743 CCGCCTATTGTCTTTCTCCGCGG + Exonic
1131211169 15:90498067-90498089 CCGCCCCTTTTGTTCCTCCATGG + Intronic
1134511048 16:14847062-14847084 CAGCTAATTTTCTTCCCCCGTGG - Intronic
1134973144 16:18549115-18549137 CAGCTAATTTTCTTCCCCCGTGG + Intronic
1138083156 16:54111007-54111029 GCCCCAATTTTTTTCCTGTGAGG + Intronic
1141261536 16:82458838-82458860 TCACTAATTGTTTTCCTCCGTGG - Intergenic
1141585126 16:85028306-85028328 TCGCCAATGTCTTTCCCCCGGGG - Intronic
1149163952 17:53727219-53727241 AAGCCATTTTTTTTCCTCTGAGG + Intergenic
1149290844 17:55216233-55216255 CAGCCAAATTCCTTCCTCCGAGG + Intergenic
1149762396 17:59243992-59244014 CGGTCAATTTTTTTCTTCTGAGG - Intronic
1150249858 17:63699553-63699575 CCGCTAACTTTGTTCTTCCGAGG - Intronic
1151801574 17:76382625-76382647 CCCCCTTTTTTTTTCCTCCTGGG - Intronic
1159826170 18:73213325-73213347 CCCCCTATTTTTTTCCTCTGTGG - Intronic
1160600569 18:80009544-80009566 CAGCCAAATTCTTTCCTCCAAGG - Intronic
1166773138 19:45296741-45296763 CCTCCAATTTCTATCCTCCCAGG - Intronic
926598224 2:14813879-14813901 CCCCCAAATTTTTTCCTTCTAGG - Intergenic
927376892 2:22427679-22427701 TTGCCAATTTTTTTCCACCAAGG + Intergenic
929604735 2:43226769-43226791 CCGCCAATTTTTTTCCTCCGGGG + Intergenic
933069194 2:77836351-77836373 CAGCCAAATTCTTTCCTTCGAGG + Intergenic
939454151 2:142411101-142411123 CAGTCAATTTTTTTCTTCTGAGG + Intergenic
939614702 2:144349371-144349393 CCTCCAATTTTTTTTCTTAGAGG - Intergenic
940782988 2:157952936-157952958 TAGCCAAATTTTTTCCTCTGAGG + Intronic
942996175 2:182263277-182263299 CTGCCTATTTTTTTTCTCCTGGG + Intronic
944905575 2:204258490-204258512 CCTCCAATTATCTTCCTCCAGGG - Intergenic
945918659 2:215731621-215731643 TAGCAAATTTTTTTCCTCTGTGG - Intergenic
947602519 2:231463495-231463517 CCGCCCACATTTTTCCTCCCAGG + Intronic
1171071708 20:22075414-22075436 CTGCCAATTTTTTTCCAAAGTGG + Intergenic
950627663 3:14260011-14260033 CACCCATTTTTTTTCCTCTGAGG - Intergenic
953790093 3:45940782-45940804 CGGCCAAATTCTTTCCTCCAAGG + Intronic
961664843 3:128488686-128488708 GTGGCATTTTTTTTCCTCCGGGG + Intronic
963772794 3:149405926-149405948 CCTCCAATTTTCTTCCTCAGAGG - Intergenic
964384717 3:156135314-156135336 CCCCCATTTTTTTTCCCCAGAGG + Intronic
967141901 3:186568598-186568620 CCTCCTATTTTTTTCATCCCTGG - Intronic
969637648 4:8378558-8378580 CCGCCCATCTTTTTACTCCCAGG + Intronic
974166922 4:58215436-58215458 CACCCAAGTTTTTTCCTCCGAGG - Intergenic
975984211 4:80188167-80188189 CTCCCAATTTTTTTCCTCTTTGG - Intronic
980320199 4:131262468-131262490 CCCCCTTTTTTTTTCCCCCGTGG - Intergenic
981057624 4:140381541-140381563 ACACCAATTTTTTTCCTTAGCGG - Exonic
981450092 4:144886620-144886642 CCGTCAAATTCTTTCTTCCGAGG + Intergenic
984836101 4:184022757-184022779 CCTCCACTTCCTTTCCTCCGAGG + Exonic
985319745 4:188697196-188697218 TCTTCAATTTTTTTCCTCCAGGG + Intergenic
985372325 4:189299139-189299161 TCTCCAATTTTATTCCTCAGAGG - Intergenic
986489578 5:8275292-8275314 CAGCAAATATTTTTCCTCCCAGG - Intergenic
986494035 5:8323629-8323651 TGGCCAGTTTTTTTCCTCTGGGG - Intergenic
986578073 5:9233461-9233483 CCCCCACTTTTTTTCCCCCATGG + Intronic
987825095 5:23020781-23020803 CCCCCAATTTTTTTTCTACCTGG - Intergenic
988014059 5:25530324-25530346 CAAACAATTTTTTTCCTCCTAGG - Intergenic
993572625 5:89560835-89560857 AAGCCAATTGTTTTCCTCCTAGG + Intergenic
994158620 5:96530650-96530672 CCTCCAGTTTTTCTCCTCCTGGG - Intronic
994281441 5:97908191-97908213 CAGCCAAATTCTTTCCTCTGAGG + Intergenic
997205485 5:132046433-132046455 CTGGCAATTTTTTTCTTCCTTGG - Intergenic
998388948 5:141774557-141774579 CAGCCCACTTTTTTCCTCGGGGG + Intergenic
1005015361 6:21370239-21370261 CCTCCAATTCTTTTTCTCTGAGG - Intergenic
1005360743 6:25028669-25028691 CCCCCAATTTTTTTCTTATGTGG - Intronic
1010642206 6:78342357-78342379 CTTCCAATTTTTTTCCTTCCTGG - Intergenic
1010812752 6:80318384-80318406 CCCCCAATTTTTTTGATCTGTGG - Intronic
1012493650 6:99810824-99810846 CAGCCAAATTATTTCCTCCAAGG - Intergenic
1013866845 6:114708639-114708661 CAGCCAAATTCTTTCCTCTGAGG + Intergenic
1017426978 6:154332061-154332083 CAGCCAAATTCTTTCCTCTGAGG + Intronic
1024542634 7:50491344-50491366 CCACCTATTTTTTTCCTTCATGG + Intronic
1025561695 7:62379579-62379601 ACGGCATTTTTTTTCCGCCGCGG + Intergenic
1038836664 8:31132480-31132502 CTTCCAATTTTATTTCTCCGAGG + Exonic
1042017455 8:64330617-64330639 TCTCCAAATTTTTTCCTCAGGGG - Intergenic
1042761749 8:72278649-72278671 CAGGCAATTTTTTTCTTCTGAGG + Intergenic
1046839468 8:118841192-118841214 AAACCAATTTTTTTCCTCCCAGG - Intergenic
1048070194 8:131012845-131012867 CTTCCAACTTTTCTCCTCCGTGG + Intronic
1052911610 9:33887594-33887616 CCGCTAGTTTTTTTCCTTTGAGG + Intronic
1056654960 9:88501660-88501682 CCAGCAATTCTTTTCCTCAGTGG + Intergenic
1062244122 9:135555011-135555033 CTGCCAATTGTTTTCCACAGTGG + Intergenic
1190453579 X:50604136-50604158 CCGCCAATATTTTTTATCCTAGG + Intronic
1191671476 X:63752313-63752335 TGGACAATTTTTTTCCTCCTCGG - Intronic
1191899304 X:66024207-66024229 ATCCCAATTTTTTTCCTCCTCGG + Intronic
1192904731 X:75538964-75538986 CTTCCAATTTTTTTCCACTGTGG + Intergenic
1199821649 X:151455390-151455412 CCGCCAATTGTTTTCCAAAGTGG + Intergenic
1200558745 Y:4671350-4671372 CAGCCAATTTATTTTCTCCAAGG + Intergenic