ID: 929604738

View in Genome Browser
Species Human (GRCh38)
Location 2:43226773-43226795
Sequence CAATTTTTTTCCTCCGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 124}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929604728_929604738 -5 Left 929604728 2:43226755-43226777 CCTCCCATTGGCCGCCGCCAATT 0: 1
1: 0
2: 0
3: 3
4: 38
Right 929604738 2:43226773-43226795 CAATTTTTTTCCTCCGGGGGAGG 0: 1
1: 1
2: 0
3: 8
4: 124
929604720_929604738 28 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604738 2:43226773-43226795 CAATTTTTTTCCTCCGGGGGAGG 0: 1
1: 1
2: 0
3: 8
4: 124
929604729_929604738 -8 Left 929604729 2:43226758-43226780 CCCATTGGCCGCCGCCAATTTTT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 929604738 2:43226773-43226795 CAATTTTTTTCCTCCGGGGGAGG 0: 1
1: 1
2: 0
3: 8
4: 124
929604718_929604738 29 Left 929604718 2:43226721-43226743 CCCGCCCGCTCGCGGACGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 929604738 2:43226773-43226795 CAATTTTTTTCCTCCGGGGGAGG 0: 1
1: 1
2: 0
3: 8
4: 124
929604726_929604738 0 Left 929604726 2:43226750-43226772 CCCGGCCTCCCATTGGCCGCCGC 0: 1
1: 0
2: 0
3: 15
4: 171
Right 929604738 2:43226773-43226795 CAATTTTTTTCCTCCGGGGGAGG 0: 1
1: 1
2: 0
3: 8
4: 124
929604721_929604738 25 Left 929604721 2:43226725-43226747 CCCGCTCGCGGACGTCAGGCGCC 0: 1
1: 0
2: 1
3: 0
4: 38
Right 929604738 2:43226773-43226795 CAATTTTTTTCCTCCGGGGGAGG 0: 1
1: 1
2: 0
3: 8
4: 124
929604727_929604738 -1 Left 929604727 2:43226751-43226773 CCGGCCTCCCATTGGCCGCCGCC 0: 1
1: 0
2: 2
3: 25
4: 238
Right 929604738 2:43226773-43226795 CAATTTTTTTCCTCCGGGGGAGG 0: 1
1: 1
2: 0
3: 8
4: 124
929604730_929604738 -9 Left 929604730 2:43226759-43226781 CCATTGGCCGCCGCCAATTTTTT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 929604738 2:43226773-43226795 CAATTTTTTTCCTCCGGGGGAGG 0: 1
1: 1
2: 0
3: 8
4: 124
929604722_929604738 24 Left 929604722 2:43226726-43226748 CCGCTCGCGGACGTCAGGCGCCT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 929604738 2:43226773-43226795 CAATTTTTTTCCTCCGGGGGAGG 0: 1
1: 1
2: 0
3: 8
4: 124
929604725_929604738 4 Left 929604725 2:43226746-43226768 CCTTCCCGGCCTCCCATTGGCCG 0: 1
1: 0
2: 1
3: 28
4: 203
Right 929604738 2:43226773-43226795 CAATTTTTTTCCTCCGGGGGAGG 0: 1
1: 1
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929604738 Original CRISPR CAATTTTTTTCCTCCGGGGG AGG Intergenic
902381167 1:16053007-16053029 CAAGTTTTTTTCCCTGGGGGAGG + Intronic
902745696 1:18472892-18472914 TGATTTTTTTTCTCCTGGGGTGG - Intergenic
903605393 1:24571874-24571896 TAATTTTTTTCTTCCAGGCGCGG - Intronic
905971439 1:42145222-42145244 CATTGTTATTCCTGCGGGGGCGG + Intergenic
910458837 1:87426600-87426622 CATTTTTTTTTCCCAGGGGGTGG + Intergenic
910606874 1:89096100-89096122 CAATTTTGTTCCTCTGCGTGTGG - Intergenic
911594495 1:99785077-99785099 TACTTTTTTTTCTCCAGGGGAGG - Intergenic
912231270 1:107795524-107795546 CATTTTTTTTCCTGGGGGGAGGG - Intronic
918220006 1:182428084-182428106 CAAGTCTTTTCCTGCAGGGGTGG - Intergenic
918862191 1:189844179-189844201 AAATTTTTTTCTTCTGGCGGAGG + Intergenic
919635094 1:199996184-199996206 AAATATTTTTCCACCGGGTGCGG - Intergenic
919985535 1:202671422-202671444 AAACTTTTTTCCTCAGTGGGAGG - Intronic
920666018 1:207963540-207963562 CCATTTGTTCCCTCCCGGGGCGG + Intergenic
923113772 1:230914858-230914880 CAAATTTTTGCCTGCTGGGGTGG + Intronic
1062958317 10:1554533-1554555 CAACTTTCTTCCCCCGGGGGAGG + Intronic
1063526277 10:6789394-6789416 CAAATTTATTCCTCCTTGGGAGG - Intergenic
1065578565 10:27148800-27148822 CAAATTTTTGACTACGGGGGAGG + Intronic
1066350706 10:34634404-34634426 TAATGTTTTCCCTCCAGGGGAGG + Intronic
1066669047 10:37817533-37817555 CAATTTTTTCCCTACTGAGGAGG + Intronic
1068505152 10:57891086-57891108 CAATTTTTTTCCACAGATGGTGG - Intergenic
1072915945 10:99537387-99537409 CACTTTTTGTGCTCTGGGGGAGG + Intergenic
1074249369 10:111729119-111729141 CCCTTTTTTTCCTCTGGGGAAGG + Intergenic
1080963204 11:37184450-37184472 CAAGTTTTTTCCTATGGGGAAGG - Intergenic
1081223701 11:40495292-40495314 TAATTTTTTTCTGGCGGGGGGGG - Intronic
1086661318 11:89422477-89422499 CAATGTTATTGCTCTGGGGGAGG + Intronic
1090255549 11:125281205-125281227 CAATCTCTTTCCTCCTGAGGTGG - Intronic
1093984384 12:25512850-25512872 CAATTTTTTTTTTATGGGGGGGG + Intronic
1095460910 12:42443509-42443531 CAAATTCTGTCCTCCAGGGGAGG - Intronic
1098222702 12:68286749-68286771 TAATTTTTTTTTTGCGGGGGCGG - Intronic
1099166838 12:79317419-79317441 CAATTATTTTCCCCCTGGGACGG + Intronic
1099384584 12:81998979-81999001 GAATTTTTTTCCTCAGAGGAAGG - Intergenic
1099653745 12:85462448-85462470 CAATTTTTTTACTCCTAGTGAGG - Intergenic
1102936786 12:116904163-116904185 CACGTTTTTTTCTCCAGGGGAGG + Intergenic
1105477224 13:20739043-20739065 AAAGTTTCTTCCTCCTGGGGGGG + Intronic
1107398079 13:40039249-40039271 AAATTTATTTCCTCTGGTGGTGG + Intergenic
1108947823 13:56045234-56045256 CAATTTTTTTTTTGGGGGGGTGG - Intergenic
1109827869 13:67746438-67746460 TCATTTTTTTCCTCCGTGTGGGG + Intergenic
1109924367 13:69115795-69115817 CTTTTTTTTTCTTCCAGGGGAGG + Intergenic
1112430627 13:99347325-99347347 CCTTTTTTTTCCTGGGGGGGGGG - Intronic
1116234811 14:42266156-42266178 CAATTTTTTTCCTCAGTGTTGGG + Intergenic
1117654306 14:57938999-57939021 CAATTTCTTTCCTCCCCTGGAGG + Intronic
1121424724 14:93841684-93841706 CAATTTTTTTTTTTGGGGGGGGG - Intergenic
1121944744 14:98108729-98108751 TAATTTTTTTCCTCTGGAAGGGG + Intergenic
1124439589 15:29676305-29676327 CAATTTTTTTTGGCCGGGTGCGG + Intergenic
1126205124 15:46036579-46036601 CAATTGTTTTCCTCAGGGAATGG + Intergenic
1126725742 15:51629889-51629911 CAATTTTTTTCCTGCAGGCAGGG - Intergenic
1127217962 15:56844855-56844877 CAATTTTTTTGTTCCAGGTGTGG - Intronic
1128801579 15:70500500-70500522 CGAATGTTTTCCTCCGGGGCTGG - Intergenic
1136361764 16:29785152-29785174 CAGTTTCTTGCCTCCGTGGGTGG - Intergenic
1136362562 16:29790414-29790436 CAGTTTCTTGCCTCCGTGGGTGG - Intergenic
1137015236 16:35367716-35367738 CAATATTTTTCCTGTGGGTGGGG + Intergenic
1146983860 17:37193646-37193668 CATTTTTTTTCCCCTGGGAGAGG - Intronic
1147365212 17:39954541-39954563 CATTTTTTCTCCTCCAGGAGAGG - Intergenic
1153594393 18:6709883-6709905 AAATTGTTTTCCTTCAGGGGTGG - Intergenic
1158236447 18:55321448-55321470 CTATTTTTCTACTCTGGGGGAGG + Intronic
1158740486 18:60136226-60136248 CCATTTTTTTCCTTGGGGGTGGG + Intergenic
1165648994 19:37469320-37469342 CCCTTTGTGTCCTCCGGGGGCGG + Exonic
929604738 2:43226773-43226795 CAATTTTTTTCCTCCGGGGGAGG + Intergenic
929815579 2:45228746-45228768 CTCTTTTTTTCCTCTGGGAGTGG + Intergenic
930600390 2:53436131-53436153 CAATTTTTTTCCTGGCGTGGTGG - Intergenic
931705618 2:64944135-64944157 CATTTCTTTTGCTCCAGGGGTGG - Intergenic
938022116 2:127914512-127914534 CAATCTTTTTGCTGCTGGGGGGG + Intergenic
940132216 2:150394967-150394989 CAAACTTTTTCCTCATGGGGAGG - Intergenic
942157937 2:173150850-173150872 CAATTTTTTTTGGCCGGGTGTGG - Intronic
942243998 2:173990625-173990647 CAGTTTCTTTCCTGCTGGGGTGG + Intergenic
944409125 2:199419890-199419912 TTATTTTTTTCTTCAGGGGGTGG - Intronic
945774536 2:214088688-214088710 CAATTTTTTTCCCCAGGGTATGG - Intronic
946507556 2:220317781-220317803 CAGTTTTTTGCCGCCTGGGGAGG + Intergenic
946592507 2:221266272-221266294 CTATTTCTTTCCTGAGGGGGGGG - Intergenic
946945379 2:224816050-224816072 CAGTTTTTTTCTTGCGGGGGAGG - Intronic
948483192 2:238263175-238263197 CAACTTTTGATCTCCGGGGGTGG - Intronic
948828604 2:240586550-240586572 GTATTTTTTCCTTCCGGGGGCGG - Intergenic
1171480987 20:25455499-25455521 CATTTATTTTCCTCCGGGAATGG - Intronic
1174288005 20:49485550-49485572 CAGTTTTTGTCCTCCAGGGCAGG - Intergenic
1174701974 20:52618093-52618115 CATTTTTTTTCCTGAGTGGGGGG + Intergenic
1174808197 20:53622999-53623021 GGATTTTTTTGCTGCGGGGGAGG - Intergenic
1182526094 22:30920977-30920999 CATTTTTTATCCTCTGGGGGAGG + Intergenic
949192726 3:1269130-1269152 CATTTTTTTTCCTCTGAGGCAGG + Intronic
950063028 3:10088115-10088137 CAATCTTGTTCCTCCTGGGCTGG - Intronic
953103303 3:39851459-39851481 CCACTTTTTTCCTCAGGGTGTGG + Intronic
957170696 3:76733194-76733216 CTATTTTTTTCCTTCTGGGCAGG - Intronic
957420429 3:79961196-79961218 CTATTTTTTTCCCCCAGGGGAGG + Intergenic
958925089 3:100148949-100148971 CAATTTATTTCCTCAAGGTGGGG + Intronic
959700116 3:109290816-109290838 GAATTTTTTTTCTCCTGGGAGGG + Intergenic
961664847 3:128488690-128488712 CATTTTTTTTCCTCCGGGGGGGG + Intronic
963188784 3:142446725-142446747 GTATTTTTTTCCCCCGGGGAGGG - Intronic
966064172 3:175796337-175796359 CAATTATTTTCCTCTGTGTGTGG - Intronic
967993452 3:195149321-195149343 CAATTGTTTTCATCCGATGGGGG + Intronic
968313721 3:197704870-197704892 CACTTTTTCTCCTCTGGGGAAGG - Intronic
970495122 4:16617296-16617318 CCATTTTTTTTTTCCCGGGGAGG - Intronic
974434501 4:61839776-61839798 TAATTTTTTTTTTCGGGGGGAGG - Intronic
975661168 4:76689929-76689951 CAATTATTTTCCTCTTGGAGTGG - Intronic
977226734 4:94401150-94401172 CAATTTTTTTCCCCTGGGGTAGG - Intergenic
980195627 4:129584265-129584287 AGATTTTTTTCCTCTGAGGGAGG + Intergenic
981057622 4:140381537-140381559 CAATTTTTTTCCTTAGCGGAAGG - Exonic
981289451 4:143057056-143057078 GAATTTTTTTCCTTCTTGGGTGG - Intergenic
983296431 4:165873879-165873901 CCCTCCTTTTCCTCCGGGGGAGG + Exonic
984968720 4:185167044-185167066 CAATTTTTTTCCTTCCAGTGTGG + Intronic
987029293 5:13961015-13961037 CAATTTCTTTCCTCCCTTGGAGG - Intergenic
988636899 5:32994710-32994732 CAAATTTTTACCTGCAGGGGAGG - Intergenic
995257473 5:110063921-110063943 AATATTTTTTCCTGCGGGGGTGG - Intergenic
997925826 5:138030714-138030736 CAATTTTTTTTTTTGGGGGGGGG - Intronic
998388951 5:141774561-141774583 CCACTTTTTTCCTCGGGGGCAGG + Intergenic
1000723211 5:164734625-164734647 CAATTTTTTTTTTTGGGGGGGGG + Intergenic
1003093452 6:3123300-3123322 AAATGATTTTCCTCTGGGGGTGG + Intronic
1003489004 6:6605279-6605301 CAGTTTTTTTCCTCTGGGGCAGG + Intronic
1003740558 6:8933540-8933562 CAATTCTTTTCCTCTGGAAGGGG - Intergenic
1006662961 6:35664458-35664480 CATTGTTCTTCCTCCGGGAGTGG - Intronic
1007982521 6:46173223-46173245 CAATTTTCTTCGTCAGGGGCTGG + Intergenic
1014076162 6:117236884-117236906 GTATTTTTTTCCTCGGGGGCGGG + Intergenic
1017178287 6:151525578-151525600 CAATTTTTGTGGTCAGGGGGTGG - Intronic
1021543600 7:21788574-21788596 CAATTTTTTTTCTGCTGGTGGGG - Intronic
1022097407 7:27149479-27149501 CAATTTTTTCCCTTTGTGGGAGG - Intronic
1028401411 7:90429598-90429620 TAATTTTTGTCCTCTGGGAGAGG - Intronic
1029485998 7:100841079-100841101 AATTTTTTTTCCTTAGGGGGTGG + Intronic
1034129749 7:148704163-148704185 CCATTTTTTTCCACGGGGGTGGG - Intronic
1039410674 8:37352659-37352681 CAGTTTTTGTCCTCCCGAGGGGG - Intergenic
1041473710 8:58239278-58239300 CAATTTTTTTTGTGGGGGGGGGG - Intergenic
1043038177 8:75225079-75225101 TAATCTTTCTCCTCCAGGGGAGG - Intergenic
1045548073 8:103146186-103146208 CAGTTTTTTTCTGCCTGGGGAGG + Intronic
1046899267 8:119506311-119506333 CATTTGTTTTTCTCAGGGGGAGG + Intergenic
1049316922 8:141974307-141974329 CTGTTTTTTTCCCCAGGGGGTGG + Intergenic
1061091667 9:128429942-128429964 CATTTTTTTTAATCCGGGTGTGG - Intronic
1186996711 X:15131404-15131426 CAATTTTTTTCCACAGACGGGGG - Intergenic
1191671474 X:63752309-63752331 CAATTTTTTTCCTCCTCGGTGGG - Intronic
1191899307 X:66024211-66024233 CAATTTTTTTCCTCCTCGGTTGG + Intronic
1192607009 X:72528764-72528786 CACTACTTTTCCTCAGGGGGTGG + Intronic
1193269953 X:79516946-79516968 CAATTTTTTTCCTTCCTAGGTGG - Intergenic
1194300242 X:92177570-92177592 CAAATTTTTCCCTCTGGGGCCGG + Intronic
1196652997 X:118187857-118187879 CAATTTTTTTTTTCGGAGGGGGG + Intergenic
1199235318 X:145486151-145486173 CACCTTTTTTCCCCCTGGGGAGG - Intergenic
1201549365 Y:15203792-15203814 CATTTTTTTCCCACTGGGGGTGG + Intergenic
1202181892 Y:22146872-22146894 TTTTTTTTTTCCTCAGGGGGAGG + Intergenic
1202209468 Y:22439530-22439552 TTTTTTTTTTCCTCAGGGGGAGG - Intergenic