ID: 929604739

View in Genome Browser
Species Human (GRCh38)
Location 2:43226774-43226796
Sequence AATTTTTTTCCTCCGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 170}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929604722_929604739 25 Left 929604722 2:43226726-43226748 CCGCTCGCGGACGTCAGGCGCCT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 929604739 2:43226774-43226796 AATTTTTTTCCTCCGGGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 170
929604728_929604739 -4 Left 929604728 2:43226755-43226777 CCTCCCATTGGCCGCCGCCAATT 0: 1
1: 0
2: 0
3: 3
4: 38
Right 929604739 2:43226774-43226796 AATTTTTTTCCTCCGGGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 170
929604725_929604739 5 Left 929604725 2:43226746-43226768 CCTTCCCGGCCTCCCATTGGCCG 0: 1
1: 0
2: 1
3: 28
4: 203
Right 929604739 2:43226774-43226796 AATTTTTTTCCTCCGGGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 170
929604727_929604739 0 Left 929604727 2:43226751-43226773 CCGGCCTCCCATTGGCCGCCGCC 0: 1
1: 0
2: 2
3: 25
4: 238
Right 929604739 2:43226774-43226796 AATTTTTTTCCTCCGGGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 170
929604726_929604739 1 Left 929604726 2:43226750-43226772 CCCGGCCTCCCATTGGCCGCCGC 0: 1
1: 0
2: 0
3: 15
4: 171
Right 929604739 2:43226774-43226796 AATTTTTTTCCTCCGGGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 170
929604720_929604739 29 Left 929604720 2:43226722-43226744 CCGCCCGCTCGCGGACGTCAGGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 929604739 2:43226774-43226796 AATTTTTTTCCTCCGGGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 170
929604718_929604739 30 Left 929604718 2:43226721-43226743 CCCGCCCGCTCGCGGACGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 929604739 2:43226774-43226796 AATTTTTTTCCTCCGGGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 170
929604730_929604739 -8 Left 929604730 2:43226759-43226781 CCATTGGCCGCCGCCAATTTTTT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 929604739 2:43226774-43226796 AATTTTTTTCCTCCGGGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 170
929604729_929604739 -7 Left 929604729 2:43226758-43226780 CCCATTGGCCGCCGCCAATTTTT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 929604739 2:43226774-43226796 AATTTTTTTCCTCCGGGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 170
929604721_929604739 26 Left 929604721 2:43226725-43226747 CCCGCTCGCGGACGTCAGGCGCC 0: 1
1: 0
2: 1
3: 0
4: 38
Right 929604739 2:43226774-43226796 AATTTTTTTCCTCCGGGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929604739 Original CRISPR AATTTTTTTCCTCCGGGGGA GGG Intergenic
901616043 1:10540591-10540613 AATTTTTTTTTTCCTGGAGATGG - Intronic
902961675 1:19968043-19968065 AATTTATTCCCTCCAGGGAATGG + Intergenic
903224278 1:21885991-21886013 AATGTTCTTCCTCAGGGAGATGG + Intronic
904423264 1:30407658-30407680 AATTTGTCTCATCCTGGGGAAGG + Intergenic
904631364 1:31844959-31844981 AATTTTTTTCTTGTGGGGAAGGG - Intergenic
907696564 1:56736154-56736176 ATTTTTTTTCCTTTGGAGGATGG + Intronic
908495962 1:64695247-64695269 AAATTTCTTCCTCAAGGGGAGGG - Intergenic
910922390 1:92363055-92363077 CATTTTTTTCCCCCTGGAGAAGG - Intronic
912817906 1:112844269-112844291 AATTTTTTTTGGGCGGGGGATGG - Intergenic
917256916 1:173125311-173125333 ATTTTTTTTCTTCCGGCTGATGG + Intergenic
918390082 1:184050930-184050952 AATTGTTTTCTGCTGGGGGATGG + Intergenic
918862192 1:189844180-189844202 AATTTTTTTCTTCTGGCGGAGGG + Intergenic
919985534 1:202671421-202671443 AACTTTTTTCCTCAGTGGGAGGG - Intronic
920959925 1:210655133-210655155 AATTGTTGGCCTCCGGGGAAGGG - Intronic
921451409 1:215310993-215311015 AATGTTTTTCCTCCAGGATAGGG - Intergenic
1065578566 10:27148801-27148823 AAATTTTTGACTACGGGGGAGGG + Intronic
1066350707 10:34634405-34634427 AATGTTTTCCCTCCAGGGGAGGG + Intronic
1066669048 10:37817534-37817556 AATTTTTTCCCTACTGAGGAGGG + Intronic
1068309916 10:55263612-55263634 AATGTTTCTCCACTGGGGGAAGG + Intronic
1068706193 10:60078689-60078711 AATCTTTTTCCTGGGGGGAAGGG + Intronic
1070430912 10:76336673-76336695 TTTTTTTTTCCTTTGGGGGAGGG - Intronic
1072290978 10:93964258-93964280 AATTTTTTCTTTCCTGGGGAGGG + Intergenic
1072915946 10:99537388-99537410 ACTTTTTGTGCTCTGGGGGAGGG + Intergenic
1074229938 10:111523681-111523703 AACTTTTTTCCTCTGGGAAATGG + Intergenic
1082856945 11:57816743-57816765 GATTTTTTTCCTGATGGGGAAGG + Exonic
1092512194 12:9168968-9168990 AATTATTTTTTTCCAGGGGATGG - Exonic
1093121429 12:15276051-15276073 AAGTTATTTCATCCGGTGGAAGG - Intronic
1093208271 12:16277745-16277767 TATTTTTTTCATCAGAGGGATGG - Intergenic
1098567745 12:71954832-71954854 AATTTTTTTTTTCGTGGGGATGG + Intronic
1099970765 12:89497723-89497745 AATGTTTTTCCTGAGAGGGATGG + Intronic
1101269801 12:103131662-103131684 AATATTTTTCCTCAGGGAGTTGG + Intergenic
1102936787 12:116904164-116904186 ACGTTTTTTTCTCCAGGGGAGGG + Intergenic
1103180677 12:118908724-118908746 GATTTTTTTCCCCTCGGGGAAGG + Intergenic
1106036968 13:26051924-26051946 AGTTTCTTTCCTCCGGGCTACGG + Intergenic
1106373969 13:29165797-29165819 TATTTTTTTCCTACTGTGGATGG + Intronic
1107676482 13:42803006-42803028 AATTTCTTTCCTCCTTGGAAAGG + Intergenic
1109329384 13:60909334-60909356 GATTCTTTTCCTCCCGGGGAAGG + Intergenic
1109706074 13:66094458-66094480 AATTTTTCCCCTTCTGGGGAAGG + Intergenic
1113092143 13:106627477-106627499 CATTTTTTTCCTCCTGTGGGAGG + Intergenic
1113824113 13:113237039-113237061 ATTTTTTTTTCTCCCGTGGATGG - Intronic
1118355178 14:65007835-65007857 AATTTGTTTTCTCCTGGGCAAGG + Intronic
1119232585 14:72992580-72992602 AATTTTCTACCTCTGGGGGGAGG + Intronic
1119738081 14:76996667-76996689 TATTTTTTTGCTCCTTGGGAAGG - Intergenic
1120076647 14:80166491-80166513 TTTTTTTTTCCTCCAGGGTAAGG - Intergenic
1120543284 14:85778120-85778142 AATTTTTTGCCGGCAGGGGATGG + Intergenic
1120585880 14:86311957-86311979 AATTTTTTTATTACTGGGGATGG - Intergenic
1120815542 14:88853540-88853562 AATTTTTTTCATCTGGGAAAAGG - Intronic
1122729965 14:103789221-103789243 AATTTTTTTTTTGGGGGGGATGG + Intronic
1124000956 15:25759278-25759300 AATTTTTATCCTCAGGTAGAAGG + Intronic
1126011925 15:44311308-44311330 AATGTTTTTCCTCTTAGGGAGGG - Intronic
1130034695 15:80347456-80347478 AATTTGTTTCCTCTGGAGAATGG + Intronic
1130705724 15:86231355-86231377 AATTTGATTCCTTCTGGGGACGG - Intronic
1136866304 16:33758362-33758384 AATTCTTTTTCTCCTGGGGGCGG + Intergenic
1141991329 16:87612131-87612153 AATTTTTTTCAGACGGGGGCTGG + Intronic
1203105857 16_KI270728v1_random:1357833-1357855 AATTCTTTTTCTCCTGGGGGCGG - Intergenic
1203127657 16_KI270728v1_random:1604535-1604557 AATTCTTTTTCTCCTGGGGGCGG + Intergenic
1143394103 17:6578181-6578203 TAATTTTTTTCTCGGGGGGAAGG + Exonic
1143675761 17:8431180-8431202 AATTTTTTTCCTCTTGGGATAGG + Intronic
1144963579 17:19061283-19061305 AATTTTTTTTTTAGGGGGGATGG - Intergenic
1144964111 17:19064757-19064779 AATTTTTTTTTTAGGGGGGATGG + Intergenic
1144971580 17:19113243-19113265 AATTTTTTTTTTAGGGGGGATGG + Intergenic
1144983855 17:19187387-19187409 AATTTTTTTTTTAGGGGGGATGG - Intergenic
1144984370 17:19190852-19190874 AATTTTTTTTTTAGGGGGGATGG + Intergenic
1146301321 17:31691810-31691832 TATTATTTTCCTCCAGGGCATGG - Intergenic
1146983859 17:37193645-37193667 ATTTTTTTTCCCCTGGGAGAGGG - Intronic
1148758155 17:49985426-49985448 ATTTTTGTTCCCCCTGGGGAGGG - Intergenic
1150249856 17:63699548-63699570 AACTTTGTTCTTCCGAGGGACGG - Intronic
1152550158 17:81025613-81025635 AATTGTTTTCCCCCAGTGGATGG + Intergenic
1155743157 18:29315378-29315400 AACTTTACTCCTCCAGGGGAAGG - Intergenic
1155759330 18:29545985-29546007 AATTTTTTTCCTTTGAGAGAAGG - Intergenic
1158846372 18:61447125-61447147 AAATTTTTCCCTCAAGGGGAAGG - Intronic
1161918029 19:7244846-7244868 ACTTTTTTTCCTCTGGGAAATGG + Intronic
1163427367 19:17246639-17246661 AATTTCTGGCCTCCGGGGGCAGG + Intronic
1165506007 19:36230346-36230368 AAATTTCTTCCTCCTAGGGACGG + Intronic
1165883821 19:39062940-39062962 ATTTTTTTTCCCCCTGGCGACGG + Intergenic
1166372511 19:42310063-42310085 AATCAGGTTCCTCCGGGGGAAGG - Exonic
1167824832 19:51962681-51962703 TATTTTTTTTCTCCAAGGGAAGG - Intergenic
1168153489 19:54461111-54461133 TATTTTTTGCCTCAGAGGGATGG + Exonic
928179576 2:29058637-29058659 ATTTTTTTTCCTCCTTTGGAAGG - Exonic
928211227 2:29325337-29325359 TATTATTTTCTTCAGGGGGATGG - Intronic
929565239 2:42979793-42979815 CATTTTTTTCCTCCCATGGAGGG + Intergenic
929604739 2:43226774-43226796 AATTTTTTTCCTCCGGGGGAGGG + Intergenic
929615971 2:43307835-43307857 AATTTTTTTTCTCCTGGTTATGG - Intronic
929652744 2:43698103-43698125 ACTTTTTCTCTTCTGGGGGAAGG - Intronic
932079529 2:68699059-68699081 AATCTTTCTCCTCCTGGGGAAGG + Intronic
935402718 2:102677285-102677307 TTTTTTTTTCCCCCTGGGGAGGG - Intronic
936404207 2:112187762-112187784 AAACTTTTTCATCCAGGGGATGG + Exonic
940132215 2:150394966-150394988 AAACTTTTTCCTCATGGGGAGGG - Intergenic
943067792 2:183106916-183106938 AACTTTTTTCTTCCAGGGCATGG + Intergenic
946527370 2:220535189-220535211 CATTTTTTTCCCCCTGGGGAAGG + Intergenic
946945378 2:224816049-224816071 AGTTTTTTTCTTGCGGGGGAGGG - Intronic
947387472 2:229606013-229606035 ATTTTTTTTCCACCGGAGAAGGG - Intronic
948170886 2:235901396-235901418 CATTCTTTTCCTCCAGGAGAAGG + Intronic
1170524947 20:17227873-17227895 ACTATTCTTTCTCCGGGGGATGG - Intronic
1170999789 20:21401636-21401658 TGTTTTTTTCCTTAGGGGGATGG - Intergenic
1171124919 20:22593849-22593871 AACTATTTTCCTGCAGGGGAGGG - Intergenic
1174288004 20:49485549-49485571 AGTTTTTGTCCTCCAGGGCAGGG - Intergenic
1176004777 20:62855163-62855185 AATTTTCTTTCTTTGGGGGATGG + Intronic
1177260090 21:18718747-18718769 AATTTTTTTAGTCCGGCAGAAGG + Intergenic
1178582230 21:33846801-33846823 ATTTCCTTTCCTCCTGGGGAGGG - Intronic
1178759358 21:35385941-35385963 AATTTTTTTTTTTGGGGGGACGG - Intronic
1179187539 21:39096544-39096566 AAGTTTCTTCCTCTGGGGGAAGG - Intergenic
1179292267 21:40029121-40029143 ATTTTTTTTCCTCTGGGTCAAGG + Intronic
1184867311 22:47208977-47208999 TTTTTTTTTCCTCCTGGCGAGGG + Intergenic
951274853 3:20672653-20672675 AATTTTTTTCCTGAAGGGCATGG + Intergenic
953597418 3:44330791-44330813 CAGTTTTTTCCTCTGGGGTAGGG - Intronic
954733110 3:52682282-52682304 AATTTTTTTTTTGTGGGGGAGGG - Intronic
957170695 3:76733193-76733215 TATTTTTTTCCTTCTGGGCAGGG - Intronic
957610662 3:82461144-82461166 ATTTTTTTTCTGGCGGGGGAGGG + Intergenic
958773750 3:98456993-98457015 ACTTTTTTTCCTCCTGGAGATGG - Intergenic
960050824 3:113237738-113237760 ATTTTTTTTCCTGGGGGGAAAGG - Intronic
962961254 3:140313400-140313422 ATTTTTTTTCCACCTAGGGAGGG + Intronic
962968765 3:140379563-140379585 AATGCCTTTCCTCCTGGGGAAGG + Intronic
963336192 3:143975740-143975762 CACTTTTTTCCTCCAGGAGAGGG + Intronic
964499907 3:157337677-157337699 AATTTTTTTCCACCAGGAAATGG + Intronic
964543422 3:157804825-157804847 AATTTTTTTCCTCTGCCAGAAGG + Intergenic
964717024 3:159733223-159733245 AATTTTTTTCCTCCATGGTCTGG + Intronic
967963850 3:194945392-194945414 TAATTTTTACCTCTGGGGGAGGG + Intergenic
968302027 3:197624057-197624079 AATTTTTTGCCTTGGGGGTAAGG - Intergenic
968313720 3:197704869-197704891 ACTTTTTCTCCTCTGGGGAAGGG - Intronic
970495121 4:16617295-16617317 CATTTTTTTTTTCCCGGGGAGGG - Intronic
971540660 4:27812330-27812352 AATTTTTTTTTTCAGGGAGATGG - Intergenic
973774543 4:54231969-54231991 CATTTTGTGCCTCCTGGGGACGG + Intronic
974434500 4:61839775-61839797 AATTTTTTTTTTCGGGGGGAGGG - Intronic
976266515 4:83190537-83190559 GCATTTTTTCCTCCTGGGGATGG + Intergenic
976539384 4:86255693-86255715 AATTTTATTTTTCTGGGGGATGG + Intronic
976570336 4:86600124-86600146 AATTTTTTTCTTATAGGGGAAGG + Intronic
977007853 4:91594239-91594261 AATTATTTTCCTCTGGGCCAAGG + Intronic
979208294 4:118069216-118069238 AATTGTTTTCCTAAAGGGGAAGG + Intronic
980195628 4:129584266-129584288 GATTTTTTTCCTCTGAGGGAGGG + Intergenic
981057621 4:140381536-140381558 AATTTTTTTCCTTAGCGGAAGGG - Exonic
987096436 5:14554936-14554958 AATTATAATCCTCAGGGGGATGG + Intergenic
988636898 5:32994709-32994731 AAATTTTTACCTGCAGGGGAGGG - Intergenic
991013008 5:61903375-61903397 GATTTTTTTCCTCTGGCTGAGGG - Intergenic
992115536 5:73535413-73535435 GATGTTTTTCCTCAGGAGGAGGG + Intergenic
992453401 5:76893671-76893693 AAGTGTTTTCCTCAGGGCGAGGG - Intronic
994397965 5:99242320-99242342 AATTTTTTTCCCACATGGGATGG - Intergenic
995179615 5:109218774-109218796 AAGTATTTTCCTCAGGTGGATGG + Intergenic
996380026 5:122853658-122853680 AATTTTTTTCGTACAGGTGAGGG + Intronic
996803854 5:127432907-127432929 TATTTGTTTCATCCAGGGGAGGG + Intronic
997158448 5:131581991-131582013 AATTTTTTGCCGGCAGGGGATGG - Intronic
998016148 5:138733941-138733963 ACTTTTTTTCCACCGGGTGCTGG - Intronic
998810469 5:145961319-145961341 AATTTTCTTCCTTCTCGGGAAGG + Intronic
1000729922 5:164821471-164821493 ATTTTTTTTCCTCTGAGAGAGGG - Intergenic
1000888190 5:166772384-166772406 AATTTTTTTCCTAAATGGGAAGG + Intergenic
1002117340 5:176973258-176973280 AATTTTTGTCCACTTGGGGATGG - Intronic
1002375539 5:178786458-178786480 AATATATTTCCCCCGGGGCAAGG + Intergenic
1003089184 6:3087103-3087125 AATTTTTTTCCTTATAGGGAAGG + Intronic
1004052900 6:12106351-12106373 ATTATTTTTTTTCCGGGGGATGG + Intronic
1004459595 6:15823352-15823374 AATTATTTTCCTACGGGTTATGG - Intergenic
1005999408 6:30953705-30953727 ACTTTTTTTTCTCCAGGGCATGG - Exonic
1010532419 6:76984602-76984624 AATTTTCTGCCTCCTAGGGAGGG - Intergenic
1010536922 6:77042426-77042448 ATTTTTTTTCCTTAGTGGGATGG + Intergenic
1010642204 6:78342352-78342374 AATTTTTTTCCTTCCTGGAAAGG - Intergenic
1012323582 6:97884614-97884636 AATTTTTTTAGACCTGGGGATGG + Intergenic
1013350332 6:109300011-109300033 AATTTTTATCTTCCTGAGGAAGG + Intergenic
1014076163 6:117236885-117236907 TATTTTTTTCCTCGGGGGCGGGG + Intergenic
1027914690 7:84301063-84301085 GATGTTTTTCCTGCAGGGGAGGG + Intronic
1028818395 7:95176458-95176480 GATTTTTTTTCTGGGGGGGAGGG - Intronic
1029322791 7:99779901-99779923 AATGCTTCTCCTCAGGGGGAAGG - Intronic
1037849625 8:22316473-22316495 AATTTTTTTTTTCGGGGGGGAGG + Intronic
1037990483 8:23318525-23318547 CATTTTTTTCATCTGGAGGATGG - Intronic
1040709011 8:50165018-50165040 ATTATTTTTCCTGCTGGGGAGGG - Intronic
1041846947 8:62340287-62340309 TAATTTTTTCCTCCTGGGTATGG + Intronic
1045548074 8:103146187-103146209 AGTTTTTTTCTGCCTGGGGAGGG + Intronic
1045904152 8:107323256-107323278 ACTAGTTTTCCTCCGGGGAAAGG + Intronic
1047536295 8:125723114-125723136 AATTTTTTTGGTGCGGGGGTTGG + Intergenic
1047851768 8:128864987-128865009 ATTTTTTTTCCTCCCAGGTATGG - Intergenic
1048657720 8:136560137-136560159 ATGTTTTTTCCTTTGGGGGATGG - Intergenic
1053670759 9:40359108-40359130 AATTTTTTTTCCCCGAGGAATGG + Intergenic
1054513855 9:66017193-66017215 AATTTTTTTTCCCCGAGGAATGG - Intergenic
1056441728 9:86628773-86628795 ATTTTTTTTCCAACTGGGGAAGG - Intergenic
1057994286 9:99806200-99806222 AATTTTTTTCCTTCAGGGCAAGG + Intergenic
1058741540 9:107947693-107947715 AACTTTTATCTTCCTGGGGAAGG - Intergenic
1058981124 9:110171642-110171664 AATGACTTTCCTCCAGGGGACGG - Exonic
1059470481 9:114501637-114501659 ATTTTTTTTCCTGCGATGGAAGG - Intronic
1061715463 9:132515859-132515881 AATTTTTTTCCTGTAGTGGAAGG - Intronic
1185458254 X:321173-321195 AATTTTTTTTTTGGGGGGGAGGG - Intergenic
1188552864 X:31381020-31381042 AAGTTTTTTCCTCCTAGGCATGG + Intronic
1190283853 X:48949152-48949174 GCTTTTTTCCCTCCTGGGGAAGG - Intronic
1197851047 X:130860553-130860575 AAGTTTTTTCCTTCTGAGGAAGG - Intronic
1198196081 X:134363812-134363834 ACTTTTTTGCATCCTGGGGAGGG + Intergenic
1201453065 Y:14136887-14136909 ATTTTTTTTCCTCCGTGGGTTGG - Intergenic
1201749265 Y:17414555-17414577 AATTTTTGTCCTCTGGTGGGTGG - Intergenic