ID: 929604826

View in Genome Browser
Species Human (GRCh38)
Location 2:43227098-43227120
Sequence TTGCAAAGGGTGCCCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929604812_929604826 13 Left 929604812 2:43227062-43227084 CCAGAATATCGCAACCATCCCCG 0: 1
1: 0
2: 0
3: 0
4: 23
Right 929604826 2:43227098-43227120 TTGCAAAGGGTGCCCCGGCCAGG 0: 1
1: 0
2: 1
3: 3
4: 100
929604819_929604826 -6 Left 929604819 2:43227081-43227103 CCCGCGGCCCGGCGGGTTTGCAA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 929604826 2:43227098-43227120 TTGCAAAGGGTGCCCCGGCCAGG 0: 1
1: 0
2: 1
3: 3
4: 100
929604820_929604826 -7 Left 929604820 2:43227082-43227104 CCGCGGCCCGGCGGGTTTGCAAA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 929604826 2:43227098-43227120 TTGCAAAGGGTGCCCCGGCCAGG 0: 1
1: 0
2: 1
3: 3
4: 100
929604817_929604826 -1 Left 929604817 2:43227076-43227098 CCATCCCCGCGGCCCGGCGGGTT 0: 1
1: 0
2: 1
3: 7
4: 96
Right 929604826 2:43227098-43227120 TTGCAAAGGGTGCCCCGGCCAGG 0: 1
1: 0
2: 1
3: 3
4: 100
929604818_929604826 -5 Left 929604818 2:43227080-43227102 CCCCGCGGCCCGGCGGGTTTGCA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 929604826 2:43227098-43227120 TTGCAAAGGGTGCCCCGGCCAGG 0: 1
1: 0
2: 1
3: 3
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929604826 Original CRISPR TTGCAAAGGGTGCCCCGGCC AGG Intergenic
900499941 1:2999270-2999292 TTGCAATGGGTTCCCGGGACAGG - Intergenic
902889595 1:19432583-19432605 CTGCTAAGGGTGGCCCGGCATGG + Intronic
903472683 1:23598488-23598510 TTGCAAAGGGCTCCCCAGCTTGG + Intronic
906534490 1:46544082-46544104 TGGGAAAGGGCGCCCCGTCCTGG + Intergenic
913109328 1:115642794-115642816 TGGCGAAGGCTGCCCCGGCGCGG - Intronic
913347607 1:117824280-117824302 TTGCAGAGGGTGCTCTGGCCAGG + Intergenic
917794286 1:178521573-178521595 GTGAAAAGGGTGCCCAGACCTGG - Intronic
921047877 1:211490347-211490369 GTGCAAAGGGAGCCATGGCCAGG + Intronic
1072626205 10:97113882-97113904 TTCCAAAGGGTGGCCTGACCTGG + Intronic
1074598005 10:114885097-114885119 TTTTAAAAGGTGACCCGGCCTGG + Intronic
1076482327 10:130792701-130792723 CCACAAAGGGTGCTCCGGCCAGG + Intergenic
1076787725 10:132759416-132759438 TTGCAAAGGGTGCACAGGCCTGG + Intronic
1077343536 11:2036456-2036478 TTGCATAGGGTGCTGCAGCCTGG + Intergenic
1081527355 11:43936044-43936066 ATGCAAAGGGTGGGCAGGCCTGG - Intronic
1084071616 11:66740183-66740205 GTGCAAAGGGTGACTTGGCCAGG + Intergenic
1084953407 11:72678943-72678965 TTGCAATGGGAGCCCAGGCATGG + Intergenic
1085279228 11:75319449-75319471 TTGCACAGGCTGCTCCTGCCTGG + Intronic
1088868926 11:113875334-113875356 CTGCGGAGGGCGCCCCGGCCGGG - Intronic
1090351239 11:126109947-126109969 TGGCAGAGGGTGACACGGCCAGG + Intergenic
1202826522 11_KI270721v1_random:91645-91667 TTGCATAGGGTGCTGCAGCCTGG + Intergenic
1092408201 12:8235223-8235245 CTGCACAGGGTGCCCGGGGCTGG + Intergenic
1098284612 12:68894737-68894759 TTTCTAAGGGTGTCACGGCCAGG + Intronic
1101884083 12:108646458-108646480 TTGACAAGGGTGCCCAGGACAGG - Exonic
1102861445 12:116339712-116339734 TTGAAAAGGGTATCCTGGCCGGG - Intergenic
1103704738 12:122865415-122865437 TTGCAAAGCGGCCCCTGGCCGGG - Exonic
1106124531 13:26889504-26889526 GTGCAGAGGGTGCCCTGGCAGGG + Intergenic
1106245346 13:27944891-27944913 TTGGAAAGGGTGGCCGGGCGTGG + Intergenic
1118769144 14:68929906-68929928 TTGCAAAGAGGGACCTGGCCAGG + Intronic
1119774673 14:77240801-77240823 TCTCAAGGGGTGCCCAGGCCGGG + Intronic
1121048793 14:90806456-90806478 TTGCAAAGGGTGCAGGGGGCAGG - Intronic
1122266108 14:100547631-100547653 TTGCAATGGGTGCACAGCCCAGG + Intronic
1122696420 14:103555209-103555231 TTGCAAAGGCTGCCCCTGTTTGG + Intergenic
1132722964 16:1326022-1326044 CTGCAAAGGTTGGGCCGGCCAGG + Exonic
1133229410 16:4359560-4359582 CTGCCAAGGGTCCGCCGGCCAGG + Exonic
1133349157 16:5090054-5090076 CTGCACAGGGTGCCCGGGGCTGG + Intronic
1136911492 16:34147748-34147770 TTGTAAAGGGTGCCCAGGTATGG + Intergenic
1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG + Intronic
1139447155 16:67004952-67004974 TTGCAAAGGGGCTCCCAGCCAGG + Intronic
1140475081 16:75235736-75235758 TCGTACAGGGTGCCCGGGCCAGG + Exonic
1146257305 17:31398992-31399014 TGGACAATGGTGCCCCGGCCTGG + Intronic
1148262028 17:46192878-46192900 TTGCAAACAGCCCCCCGGCCTGG + Intronic
1151670925 17:75571304-75571326 TTCTAAAGGGTGCTACGGCCTGG - Intronic
1154144555 18:11856293-11856315 TTCCATAGGGAGCCCGGGCCAGG + Intronic
1157241121 18:46010297-46010319 TTCCAAAGGGACCCCCGGGCAGG + Intronic
1158847127 18:61456268-61456290 ATGCAAAGCGTGACCTGGCCTGG + Intronic
1162861209 19:13506680-13506702 TTGCAAAGGACGCCCCCCCCGGG + Intronic
1165811487 19:38614446-38614468 CTGCAAAGGTCACCCCGGCCAGG + Intronic
927031154 2:19121777-19121799 TTCTAAAGGGTGCCCAGGCATGG - Intergenic
928982632 2:37152574-37152596 TTAAAAAGAGTGGCCCGGCCAGG - Intronic
929604826 2:43227098-43227120 TTGCAAAGGGTGCCCCGGCCAGG + Intergenic
929794715 2:45050110-45050132 TTCCAAGAGGTGCCCTGGCCAGG - Intergenic
932344929 2:70989123-70989145 CTCCAAAGGGGGCCCAGGCCTGG + Intronic
938069141 2:128299346-128299368 TTGCTAAGAGTGGGCCGGCCAGG - Intronic
938970207 2:136424677-136424699 CTGCATGGGGTGCCCCGGGCTGG + Intergenic
946639275 2:221766054-221766076 TTGCAAAAGGAGCCATGGCCAGG + Intergenic
948080846 2:235203889-235203911 TTGCAAGGGGCCCCGCGGCCTGG - Intergenic
1169203655 20:3728524-3728546 GTGCAAAGGGTGGCACGGGCAGG - Intergenic
1171812460 20:29756642-29756664 TTGTAAAGGGTGCCCAGGTATGG - Intergenic
1171906818 20:30906025-30906047 TTGTAAAGGGTGCCCAGGTATGG + Intergenic
1173094537 20:40012459-40012481 TTAAAAAGGGTGCCCAGGCATGG - Intergenic
1180340232 22:11612099-11612121 TTGTAAAGGGTGCCCAGGTATGG + Intergenic
1180983665 22:19891570-19891592 TTGCTCAGGATGCCCCAGCCTGG + Intronic
1180999540 22:19981612-19981634 TTGCAGATGGTGCCCTGGACCGG - Exonic
1182129297 22:27839247-27839269 TTGCATCGGGGGCCCCTGCCTGG + Intergenic
1182619541 22:31611343-31611365 TGGCAAGGGGTGTCCAGGCCAGG + Intronic
1183675479 22:39296907-39296929 TTGGGGAGGGAGCCCCGGCCTGG - Intergenic
1184678536 22:46056351-46056373 TGGCCAAGGGAGCCCCGGCCAGG - Intronic
1185386251 22:50532416-50532438 TGGGAAAGGGTGCCCCGGGAAGG + Intronic
949989425 3:9566234-9566256 TTGAAAAGGGTTCCCGGGCCAGG + Intergenic
951674128 3:25217800-25217822 TTGCAAAGGGAGCTCAGGACAGG - Intronic
961301350 3:125924148-125924170 CTGCACAGGGTGCCCGGGGCTGG - Intergenic
963757183 3:149247174-149247196 TTGCTCATGGTGCCCCAGCCTGG + Intergenic
966855214 3:184189121-184189143 TAGCAAAGAGGGCCCGGGCCAGG - Exonic
968791319 4:2664856-2664878 TTGAAAAGGGTGTACCAGCCGGG - Intronic
969475834 4:7422040-7422062 TAGCAAAGGGGGCACCGACCAGG - Intronic
971175040 4:24274032-24274054 TTTAAAAAAGTGCCCCGGCCAGG - Intergenic
971464936 4:26947490-26947512 CTGCAAAGAGAGCCCTGGCCCGG - Intronic
977678610 4:99774342-99774364 TTCCACAGGGAGCCCCAGCCTGG - Intergenic
979547041 4:121951096-121951118 TTCCAAGGGGTGCCCAGCCCTGG + Intronic
980686230 4:136233344-136233366 TTGCAAATGGTGCTCCTCCCAGG - Intergenic
985878520 5:2619362-2619384 TTGAAGAGGCTGCCCCTGCCAGG + Intergenic
987114432 5:14714747-14714769 TTGCAAAGAGTGGCAGGGCCTGG + Intronic
999189415 5:149735435-149735457 TTGCAAAGGGGGCTCAGGCTTGG + Intronic
1001426769 5:171628036-171628058 TTGCCAGAGGTGCCCTGGCCTGG + Intergenic
1007951747 6:45878701-45878723 TGCCAAAGAGTGCCCAGGCCTGG + Intergenic
1019479123 7:1258123-1258145 CTGCAGAGGGAGCCCGGGCCTGG + Intergenic
1020320556 7:6936123-6936145 CTGCACAGGGTGCCCGGGGCTGG + Intergenic
1035281135 7:157779223-157779245 TTGCCATGGGAGCCCCGCCCTGG + Intronic
1036650309 8:10637957-10637979 TTGCAAAGGGGACCCAGCCCTGG - Intronic
1038182554 8:25242786-25242808 TTGCCCAGGGTGCCCTGGGCTGG + Intronic
1040564845 8:48556169-48556191 GTGCCCAGGGTGCCCCCGCCCGG + Intergenic
1041454766 8:58046611-58046633 TTTCAAAGGTTGCCCCAGCAAGG - Intronic
1049148379 8:141018769-141018791 TTGTCAAGGGTGCCTTGGCCAGG - Intergenic
1049636370 8:143691692-143691714 GTGCAGAGGGGACCCCGGCCAGG + Exonic
1056552478 9:87663530-87663552 GTGCCAAGGGTGCCCAGTCCTGG - Intronic
1057047528 9:91897790-91897812 TTCCAAAGGCAGCCCAGGCCCGG + Intronic
1057251467 9:93506895-93506917 TTAAAAATCGTGCCCCGGCCAGG - Intronic
1058759800 9:108119757-108119779 TTGCCAAGGGTGCCTCAGGCTGG - Intergenic
1059430453 9:114246830-114246852 TTGGAGAGGCTGCCGCGGCCTGG + Intronic
1062424538 9:136500024-136500046 CTGCAAAGGCAGCCCCTGCCAGG + Intronic
1062436031 9:136546915-136546937 TGGCACAGGGTGCCCGTGCCTGG - Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1188040063 X:25361483-25361505 TTGAAAAGGATGTCCTGGCCGGG + Intergenic
1198394583 X:136208804-136208826 TTGCAAAGGCTAACCTGGCCTGG - Intronic
1201074867 Y:10179179-10179201 TTGTAAAGGGTGCCCAGGTATGG + Intergenic